Order Kazusa clone(s) from : ![]() |
Product ID | ORK00073 |
---|---|
Accession No | AB007884 |
Description | Cdc42 guanine nucleotide exchange factor (GEF) 9, transcript variant 1 |
Clone name | hh01267 |
Vector information | |
cDNA sequence | DNA sequence (5413 bp) Predicted protein sequence (567 aa) |
HaloTag ORF Clone |
FHC00073
![]() |
Flexi ORF Clone | FXC00073 |
Source | Human adult brain |
Rouge ID |
mKIAA0424
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3061 bp |
---|---|
Genome contig ID | gi89161218r_62671573 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 65 | 113 | PD000066 | Src homology-3 |
FPrintScan | IPR001452 | 76 | 91 | PR00452 | Src homology-3 |
IPR001452 | 93 | 102 | PR00452 | Src homology-3 | |
IPR001452 | 104 | 116 | PR00452 | Src homology-3 | |
HMMPfam | IPR001452 | 77 | 116 | PF00018 | Src homology-3 |
IPR000219 | 158 | 337 | PF00621 | DH | |
IPR001849 | 370 | 476 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR001452 | 62 | 117 | SM00326 | Src homology-3 |
IPR000219 | 158 | 337 | SM00325 | DH | |
IPR001849 | 370 | 478 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR001452 | 59 | 118 | PS50002 | Src homology-3 |
IPR000219 | 154 | 338 | PS50010 | DH | |
IPR001849 | 369 | 476 | PS50003 | Pleckstrin-like |
![]() |
---|
Primer_f | GAGCAGCAAGGGTAATCAAAG |
---|---|
Primer_r | GTGTGAAGCCAAATAGTGATC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GAGCAGCAAGGGTAATCAAAG |
Primer_r | GTGTGAAGCCAAATAGTGATC |
PCR product length | 113 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |