ROUGE |
Gene/Protein Characteristic Table for mKIAA2016 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129474 |
---|---|
T-cell lymphoma invasion and metastasis 2. RAS-related C3 botulinum substrate 1, guanine nucleotide exchange factor 1. |
|
mbg07142 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6045 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 668 bp Genome contig ID gi65550231f_3258965 PolyA signal sequence
(ATTAAA,-22) +----*----+----*----+----*----+----
ATGCAGTATATACATTAAAGGAAAGTTTGCACTGTFlanking genome sequence
(222120 - 222169) ----+----*----+----*----+----*----+----*----+----*
ATCTACTTGGTATTTCTTTTCTTACCAAGCTGGATAGTAAAGTCACGAGG
KIAA Alignment based on: KIAA2016 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 182..5377
Length: 1731 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |