Order Kazusa clone(s) from : ![]() |
Product ID | ORK00207 |
---|---|
Accession No | AB033082 |
Description | intersectin 2, transcript variant 3 |
Clone name | hh15293 |
Vector information | |
cDNA sequence | DNA sequence (5938 bp) Predicted protein sequence (1676 aa) |
Flexi ORF Clone | FXC00207 |
Source | Human adult brain |
Rouge ID |
mKIAA1256
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 760 bp |
---|---|
Genome contig ID | gi89161199r_24179239 |
PolyA signal sequence (AATAAA,-25) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 24279239 | 24436808 | 39 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR002048 | 255 | 312 | PD000012 | Calcium-binding EF-hand |
IPR001452 | 741 | 793 | PD000066 | Src homology-3 | |
IPR001452 | 881 | 930 | PD000066 | Src homology-3 | |
IPR001452 | 965 | 1013 | PD000066 | Src homology-3 | |
IPR001452 | 1043 | 1091 | PD000066 | Src homology-3 | |
IPR001452 | 1110 | 1160 | PD000066 | Src homology-3 | |
FPrintScan | IPR000108 | 1050 | 1069 | PR00499 | Neutrophil cytosol factor 2 |
IPR001452 | 1109 | 1119 | PR00452 | Src homology-3 | |
IPR000108 | 1111 | 1131 | PR00499 | Neutrophil cytosol factor 2 | |
IPR001452 | 1123 | 1138 | PR00452 | Src homology-3 | |
IPR000108 | 1131 | 1147 | PR00499 | Neutrophil cytosol factor 2 | |
IPR001452 | 1140 | 1149 | PR00452 | Src homology-3 | |
IPR000108 | 1147 | 1160 | PR00499 | Neutrophil cytosol factor 2 | |
IPR001452 | 1151 | 1163 | PR00452 | Src homology-3 | |
IPR000008 | 1565 | 1577 | PR00360 | C2 calcium-dependent membrane targeting | |
IPR000008 | 1589 | 1602 | PR00360 | C2 calcium-dependent membrane targeting | |
HMMPfam | IPR002048 | 64 | 92 | PF00036 | Calcium-binding EF-hand |
IPR002048 | 287 | 315 | PF00036 | Calcium-binding EF-hand | |
IPR001452 | 741 | 795 | PF00018 | Src homology-3 | |
IPR011511 | 881 | 933 | PF07653 | Variant SH3 | |
IPR001452 | 963 | 1016 | PF00018 | Src homology-3 | |
IPR001452 | 1035 | 1094 | PF00018 | Src homology-3 | |
IPR001452 | 1109 | 1163 | PF00018 | Src homology-3 | |
IPR000219 | 1192 | 1373 | PF00621 | DH | |
IPR001849 | 1414 | 1523 | PF00169 | Pleckstrin-like | |
IPR000008 | 1550 | 1631 | PF00168 | C2 calcium-dependent membrane targeting | |
HMMSmart | IPR000261 | 21 | 115 | SM00027 | EPS15 homology (EH) |
IPR002048 | 64 | 92 | SM00054 | Calcium-binding EF-hand | |
IPR000261 | 243 | 338 | SM00027 | EPS15 homology (EH) | |
IPR002048 | 287 | 315 | SM00054 | Calcium-binding EF-hand | |
IPR001452 | 739 | 796 | SM00326 | Src homology-3 | |
IPR001452 | 880 | 934 | SM00326 | Src homology-3 | |
IPR001452 | 963 | 1017 | SM00326 | Src homology-3 | |
IPR001452 | 1035 | 1095 | SM00326 | Src homology-3 | |
IPR001452 | 1109 | 1164 | SM00326 | Src homology-3 | |
IPR000219 | 1192 | 1373 | SM00325 | DH | |
IPR001849 | 1414 | 1525 | SM00233 | Pleckstrin-like | |
IPR000008 | 1549 | 1646 | SM00239 | C2 calcium-dependent membrane targeting | |
ProfileScan | IPR000261 | 28 | 116 | PS50031 | EPS15 homology (EH) |
IPR002048 | 60 | 95 | PS50222 | Calcium-binding EF-hand | |
IPR000261 | 250 | 339 | PS50031 | EPS15 homology (EH) | |
IPR002048 | 283 | 318 | PS50222 | Calcium-binding EF-hand | |
IPR001452 | 736 | 797 | PS50002 | Src homology-3 | |
IPR001452 | 877 | 935 | PS50002 | Src homology-3 | |
IPR001452 | 960 | 1018 | PS50002 | Src homology-3 | |
IPR001452 | 1032 | 1096 | PS50002 | Src homology-3 | |
IPR001452 | 1106 | 1165 | PS50002 | Src homology-3 | |
IPR000219 | 1188 | 1374 | PS50010 | DH | |
IPR001849 | 1413 | 1523 | PS50003 | Pleckstrin-like | |
IPR000008 | 1549 | 1631 | PS50004 | C2 calcium-dependent membrane targeting | |
ScanRegExp | IPR002048 | 73 | 85 | PS00018 | Calcium-binding EF-hand |
![]() |
Primer_f | CCCTCCGAACAGACAACATTA |
---|---|
Primer_r | GTAGCTTCAATGACATGCACC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |