Order Kazusa clone(s) from : ![]() |
Product ID | ORK00742 |
---|---|
Accession No | AB029035 |
Description | Rho guanine nucleotide exchange factor (GEF) 4, transcript variant 2 |
Clone name | hj05505s1 |
Vector information | |
cDNA sequence | DNA sequence (3800 bp) Predicted protein sequence (694 aa) |
HaloTag ORF Clone |
FHC00742
![]() |
Flexi ORF Clone | FXC00742 |
Source | Human adult brain |
Rouge ID |
mKIAA1112
by Kazusa Mouse cDNA Project
|
Note | We replaced hj05505, former representative clones for KIAA1112 with hj05505s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1713 bp |
---|---|
Genome contig ID | gi89161199f_131291474 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (229822 - 229871) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 131391474 | 131521294 | 12 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 233 | 272 | PD000066 | Src homology-3 |
FPrintScan | IPR001452 | 235 | 250 | PR00452 | Src homology-3 |
IPR001452 | 252 | 261 | PR00452 | Src homology-3 | |
IPR001452 | 263 | 275 | PR00452 | Src homology-3 | |
HMMPfam | IPR001452 | 221 | 275 | PF00018 | Src homology-3 |
IPR000219 | 312 | 491 | PF00621 | DH | |
IPR001849 | 524 | 630 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR001452 | 221 | 276 | SM00326 | Src homology-3 |
IPR000219 | 312 | 491 | SM00325 | DH | |
IPR001849 | 524 | 632 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR001452 | 225 | 277 | PS50002 | Src homology-3 |
IPR000219 | 308 | 492 | PS50010 | DH | |
IPR001849 | 523 | 630 | PS50003 | Pleckstrin-like | |
ScanRegExp | IPR001331 | 440 | 465 | PS00741 | Guanine-nucleotide dissociation stimulator |
![]() |
Primer_f | GCGTGAGAAGCCATAAGAGAG |
---|---|
Primer_r | AATGTGGTTTCTGGCTTGGAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |