Order Kazusa clone(s) from : ![]() |
Product ID | ORK05587 |
---|---|
Accession No | D87454 |
Description | kelch domain containing 10 |
Clone name | ha04704 |
Vector information | |
cDNA sequence | DNA sequence (5551 bp) Predicted protein sequence (401 aa) |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0265
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4345 bp |
---|---|
Genome contig ID | gi89161213f_129397647 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (164522 - 164571) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 129497647 | 129562167 | 10 | 99.9 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR006652 | 50 | 107 | PF01344 | Kelch repeat type 1 |
IPR011498 | 112 | 160 | PF07646 | Kelch repeat type 2 | |
IPR006652 | 165 | 210 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 218 | 265 | PF01344 | Kelch repeat type 1 | |
IPR006652 | 274 | 319 | PF01344 | Kelch repeat type 1 | |
HMMSmart | IPR006652 | 230 | 285 | SM00612 | Kelch repeat type 1 |
IPR006652 | 286 | 333 | SM00612 | Kelch repeat type 1 |
Panel name | Genebridge 4 |
---|---|
Primer_f | GGTCCTCTGATCATAAGCTCC |
Primer_r | GAGGTCGCTTTTGGCTGAATC |
PCR product length | 210 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |