KIAA1354

Product ID	ORK05773
Accession No	AB037775
Description	kelch-like family member 9
Clone name	fj01502
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4352 bp) Predicted protein sequence (632 aa)
Source	Human fetal brain
Rouge ID	mKIAA1354 by Kazusa Mouse cDNA Project

Length: 4352 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1988 bp
Genome contig ID	gi89161216r_21221019
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- GGATCTCTTTATATAATAAATGTAATTTAACTTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTGCTTGCATTTATTTCTTCCCTCAATCTGTTGTAGTTTTACAAAGGC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	21321019	21325368	1	99.0	Perfect prediction

Length: 632 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_538682	98.9	similar to kelc...	Canis lupus fam...
Q9P2J3	100.0	Kelch-like prot...	Homo sapiens
AAO39718	99.5	KLHL9 protein [...	Homo sapiens
Q2T9Z7	99.7	Kelch-like prot...	Bos taurus
EDL97739	99.2	kelch-like 9 (D...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB037730	0	92.4	KIAA1309
AB037805	2.9e-67	33.4	KIAA1384
AB051474	4.4e-52	31.0	KIAA1687
AB040923	1.2e-51	29.3	KIAA1490
AB032955	9.9e-50	30.4	KIAA1129

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	55	164	PF00651	BTB/POZ
	IPR011705	169	270	PF07707	BTB/Kelch-associated
	IPR006652	302	349	PF01344	Kelch repeat type 1
	IPR006652	351	401	PF01344	Kelch repeat type 1
	IPR006652	403	448	PF01344	Kelch repeat type 1
	IPR006652	450	495	PF01344	Kelch repeat type 1
	IPR006652	497	547	PF01344	Kelch repeat type 1
	IPR006652	551	596	PF01344	Kelch repeat type 1
HMMSmart	IPR000210	65	164	SM00225	BTB/POZ-like
	IPR006652	314	362	SM00612	Kelch repeat type 1
	IPR006652	363	414	SM00612	Kelch repeat type 1
	IPR006652	415	461	SM00612	Kelch repeat type 1
	IPR006652	462	508	SM00612	Kelch repeat type 1
	IPR006652	509	560	SM00612	Kelch repeat type 1
	IPR006652	561	609	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	65	134	PS50097	BTB/POZ-like

Primer_f	GACAGGACCAACTTCAGATTC
Primer_r	TTCCTGTAACTCCATTTGCTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-