KIAA1989

Product ID	ORK04991
Accession No	AB076400
Description	FAT atypical cadherin 3
Clone name	fh00385
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5340 bp) Predicted protein sequence (1097 aa)
Source	Human fetal brain

Length: 5340 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2045 bp
Genome contig ID	gi51511727f_92113483
PolyA signal sequence (None)	+--------+--------+----*----+---- CTTTTTTATGAGTCAGTGTTTCTGAATGTTTATGC
Flanking genome sequence (152491 - 152540)	----+--------+--------+--------+--------+----* AAAAAAAAAAATCCTTTTTCATTCCCAAACTTTCTAAGTAAGTGGATACA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	f	92213483	92265972	11	99.5	Perfect prediction

Length: 1097 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB86868	100.0	fat3 [Homo sapi...	Homo sapiens
Q8TDW7	99.9	Protocadherin F...	Homo sapiens
XP_848507	95.4	similar to FAT ...	Canis lupus fam...
EAW66887	99.9	hCG21202, isofo...	Homo sapiens
NP_001008781	97.0	FAT tumor suppr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB160984	4.7e-20	27.5	KIAA0811
AB011538	1.3e-09	25.8	KIAA0814
AB011537	6.6e-09	26.7	KIAA0813
AB058677	5.1e-06	38.6	KIAA1781
D87469	6.5e-06	24.1	KIAA0279

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002126	65	146	PF00028	Cadherin
	IPR012680	373	502	PF02210	Laminin G
	IPR006209	533	565	PF00008	EGF-like
	IPR006209	572	603	PF00008	EGF-like
	IPR006209	610	641	PF00008	EGF-like
HMMSmart	IPR006210	306	341	SM00181	EGF
	IPR001791	365	502	SM00282	Laminin G
	IPR001881	531	566	SM00179	EGF-like calcium-binding
	IPR006210	532	566	SM00181	EGF
	IPR001881	568	604	SM00179	EGF-like calcium-binding
	IPR006210	571	604	SM00181	EGF
	IPR001881	606	642	SM00179	EGF-like calcium-binding
	IPR006210	609	642	SM00181	EGF
ProfileScan	IPR002126	70	161	PS50268	Cadherin
	IPR000742	303	341	PS50026	EGF-like
	IPR001791	343	526	PS50025	Laminin G
	IPR000742	529	566	PS50026	EGF-like
	IPR000742	568	604	PS50026	EGF-like
	IPR000742	606	642	PS50026	EGF-like
ScanRegExp	IPR013032	554	565	PS00022	EGF-like region
	IPR013032	592	603	PS00022	EGF-like region
	IPR001881	606	630	PS01187	EGF-like calcium-binding
	IPR000152	621	632	PS00010	Aspartic acid and asparagine hydroxylation site
	IPR013032	630	641	PS00022	EGF-like region
	IPR013032	630	641	PS01186	EGF-like region

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	615	CENGGSCVNVFGSFLCNCTPGY	636	SECONDARY	22
SOSUI2	2	663	LIGIAVVLFVIFILVVLFIVFR	684	PRIMARY	22

Primer_f	TGAAAGTTGACAGGTTGAGGG
Primer_r	AATAATGCACAGACTAGGGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	TGAAAGTTGACAGGTTGAGGG
Primer_r	AATAATGCACAGACTAGGGAC
PCR product length	185 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles