KIAA0921

Product ID	ORK00683
Accession No	AB023138
Description	neurexin 2, transcript variant alpha-2
Clone name	ah00573
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5502 bp) Predicted protein sequence (1658 aa)
HaloTag ORF Clone	FHC00683
Flexi ORF Clone	FXC00683
Source	Human brain (amygdala)
Rouge ID	mKIAA0921 by Kazusa Mouse cDNA Project
Note	We replaced hh02750, former representative clones for KIAA0921 with ah00573. (2002/5/10)

Length: 5502 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	134 bp
Genome contig ID	gi51511727r_64031110
PolyA signal sequence (None)	+--------+--------+----*----+---- GGCTGCCTCAGGCTTCTCTTACGAAGAGGAAACGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAGAAAAGGAAAAACCCCGTGCTCGCCCCCTTCCTCCTGCCGTCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	64131110	64247236	21	99.8	Perfect prediction

Length: 1658 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50276	100.0	Neurexin 2 [Hom...	Homo sapiens
XP_001254001	98.4	similar to neur...	Bos taurus
XP_540881	96.1	similar to neur...	Canis lupus fam...
XP_508530	98.2	neurexin 2 isof...	Pan troglodytes
XP_001166041	66.6	neurexin 3 isof...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018286	1.3e-131	61.4	KIAA0743
AB011150	4.9e-87	59.8	KIAA0578
AB051550	3.8e-11	26.0	KIAA1763
AB051501	1.9e-09	26.5	KIAA1714
AB020675	2.3e-05	24.4	KIAA0868

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR012680	73	203	PF02210	Laminin G
	IPR006209	222	257	PF00008	EGF-like
	IPR012680	310	444	PF02210	Laminin G
	IPR012680	506	651	PF02210	Laminin G
	IPR006209	679	711	PF00008	EGF-like
	IPR012680	745	866	PF02210	Laminin G
	IPR012680	922	1050	PF02210	Laminin G
	IPR006209	1076	1108	PF00008	EGF-like
	IPR012680	1145	1264	PF02210	Laminin G
HMMSmart	IPR001791	65	203	SM00282	Laminin G
	IPR006210	221	258	SM00181	EGF
	IPR001791	302	444	SM00282	Laminin G
	IPR001791	498	651	SM00282	Laminin G
	IPR006210	678	712	SM00181	EGF
	IPR001791	737	866	SM00282	Laminin G
	IPR001791	914	1050	SM00282	Laminin G
	IPR006210	1075	1109	SM00181	EGF
	IPR001791	1137	1264	SM00282	Laminin G
	IPR003585	1603	1621	SM00294	Neurexin/syndecan/glycophorin C
ProfileScan	IPR001791	44	222	PS50025	Laminin G
	IPR000742	218	258	PS50026	EGF-like
	IPR001791	281	471	PS50025	Laminin G
	IPR001791	478	671	PS50025	Laminin G
	IPR000742	675	712	PS50026	EGF-like
	IPR001791	717	880	PS50025	Laminin G
	IPR001791	894	1069	PS50025	Laminin G
	IPR000742	1072	1109	PS50026	EGF-like
	IPR001791	1113	1291	PS50025	Laminin G

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	28	PPLLLLLLLALAARADGLEF	47	SECONDARY	20
SOSUI2	2	1580	STTGMVVGIVAAAALCILILLYA	1602	PRIMARY	23

Primer_f	TAGATTCCACGAGCAGCAGCC
Primer_r	GGTGTTTTCCAAGACTCAGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	GGTGTTTTCCAAGACTCAGAC
Primer_r	TAGATTCCACGAGCAGCAGCC
PCR product length	171 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles