KIAA2004

Product ID	ORK01700
Accession No	AB095925
Description	sterile alpha motif domain containing 9, transcript variant 1
Clone name	eg01144
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (6803 bp) Predicted protein sequence (1595 aa)
HaloTag ORF Clone	FHC01700
Flexi ORF Clone	FXC01700
Source

Length: 6803 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1829 bp
Genome contig ID	gi89161213r_92466768
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- TAAAAATTGTATATTAAAAAAAAAAAAAAAAAAAA
Flanking genome sequence (87999 - 87950)	----+--------+--------+--------+--------+----* AAAGACAAAAAACAATTTTGGTGAGAATGCAGACAAAGGAGAAGCCTCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	7	r	92554767	92585206	4	100.0	Perfect prediction

Length: 1595 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5K651	100.0	Sterile alpha m...	Homo sapiens
XP_001167273	99.4	sterile alpha m...	Pan troglodytes
XP_001090497	95.2	similar to ster...	Macaca mulatta
XP_592017	80.2	sterile alpha m...	Bos taurus
XP_575365	76.4	similar to ster...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB095926	0	60.2	KIAA2005
AB028945	0.001	40.3	KIAA1022

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001660	18	70	PF00536	Sterile alpha motif SAM
HMMSmart	IPR001660	17	83	SM00454	Sterile alpha motif SAM
ProfileScan	IPR001660	20	66	PS50105	Sterile alpha motif SAM

Primer_f	CCTTCACAAATACAGCAACAG
Primer_r	AAATGGTTAATGAGGGCTTCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-