KIAA1993

Product ID	ORK00966
Accession No	AB082524
Description	zinc finger and BTB domain containing 34
Clone name	bg00180
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (6545 bp) Predicted protein sequence (532 aa)
HaloTag ORF Clone	FHC00966
Flexi ORF Clone	FXC00966
Source	Human adult brain
Rouge ID	mKIAA1993 by Kazusa Mouse cDNA Project

Length: 6545 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4945 bp
Genome contig ID	gi89161216f_128581487
PolyA signal sequence (AATAAA,-32)	+--------+--------+----*----+---- ATAAATAAAGTCAATGGACATTGCTGTTTGTAAAT
Flanking genome sequence (106473 - 106522)	----+--------+--------+--------+--------+----* AAAAATGCTGCTAGAGCAAATGTGCTGTGGTCTCCCTCTGCGTGGGCCCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	f	128662765	128687958	2	99.0	Perfect prediction

Length: 532 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001142000	1.1e-213	99.6	zinc finger and...	Pan troglodytes
Q8NCN2	4.5e-202	100.0	Zinc finger and...	Homo sapiens
XP_548452	8.3e-201	98.6	similar to Zinc...	Canis lupus fam...
AAI60177	1.2e-200	100.0	Zinc finger and...	synthetic construct
XP_001917307	1.2e-196	98.0	zinc finger and...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB007874	6.1e-21	30.4	KIAA0414
AB007901	6.6e-11	25.7	KIAA0441
AB046792	7.8e-09	26.9	KIAA1572
AB075836	4.5e-08	52.0	KIAA1956
AB023141	5.1e-08	32.1	KIAA0924

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	54	158	PF00651	BTB/POZ
	IPR007087	404	426	PF00096	Zinc finger
	IPR007087	432	454	PF00096	Zinc finger
	IPR007087	460	483	PF00096	Zinc finger
HMMSmart	IPR000210	64	158	SM00225	BTB/POZ-like
	IPR015880	404	426	SM00355	Zinc finger
	IPR015880	432	454	SM00355	Zinc finger
	IPR015880	460	483	SM00355	Zinc finger
ProfileScan	IPR000210	64	128	PS50097	BTB/POZ-like
	IPR007087	404	431	PS50157	Zinc finger
	IPR007087	432	459	PS50157	Zinc finger
	IPR007087	460	488	PS50157	Zinc finger
ScanRegExp	IPR007087	406	426	PS00028	Zinc finger
	IPR007087	434	454	PS00028	Zinc finger
	IPR007087	462	483	PS00028	Zinc finger

Primer_f	TTGAGTAATTCCAGCCCATCC
Primer_r	GGTTGTTCATCATGGCTTCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-