Order Kazusa clone(s) from : ![]() |
Product ID | ORK00966 |
---|---|
Accession No | AB082524 |
Description | zinc finger and BTB domain containing 34 |
Clone name | bg00180 |
Vector information | |
cDNA sequence | DNA sequence (6545 bp) Predicted protein sequence (532 aa) |
HaloTag ORF Clone |
FHC00966
![]() |
Flexi ORF Clone | FXC00966 |
Source | Human adult brain |
Rouge ID |
mKIAA1993
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 4945 bp |
---|---|
Genome contig ID | gi89161216f_128581487 |
PolyA signal sequence (AATAAA,-32) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (106473 - 106522) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | f | 128662765 | 128687958 | 2 | 99.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013069 | 54 | 158 | PF00651 | BTB/POZ |
IPR007087 | 404 | 426 | PF00096 | Zinc finger | |
IPR007087 | 432 | 454 | PF00096 | Zinc finger | |
IPR007087 | 460 | 483 | PF00096 | Zinc finger | |
HMMSmart | IPR000210 | 64 | 158 | SM00225 | BTB/POZ-like |
IPR015880 | 404 | 426 | SM00355 | Zinc finger | |
IPR015880 | 432 | 454 | SM00355 | Zinc finger | |
IPR015880 | 460 | 483 | SM00355 | Zinc finger | |
ProfileScan | IPR000210 | 64 | 128 | PS50097 | BTB/POZ-like |
IPR007087 | 404 | 431 | PS50157 | Zinc finger | |
IPR007087 | 432 | 459 | PS50157 | Zinc finger | |
IPR007087 | 460 | 488 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 406 | 426 | PS00028 | Zinc finger |
IPR007087 | 434 | 454 | PS00028 | Zinc finger | |
IPR007087 | 462 | 483 | PS00028 | Zinc finger |
![]() |
Primer_f | TTGAGTAATTCCAGCCCATCC |
---|---|
Primer_r | GGTTGTTCATCATGGCTTCAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | genbank |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |