Order Kazusa clone(s) from : ![]() |
Product ID | ORK00530 |
---|---|
Accession No | AB007874 |
Description | zinc finger and BTB domain containing 43, transcript variant 1 |
Clone name | hh00161 |
Vector information | |
cDNA sequence | DNA sequence (5725 bp) Predicted protein sequence (492 aa) |
HaloTag ORF Clone |
FHC00530
![]() |
Flexi ORF Clone | FXC00530 |
Source | Human adult brain |
Rouge ID |
mKIAA0414
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 425 | 448 | PD000003 | Zinc finger |
HMMPfam | IPR013069 | 48 | 152 | PF00651 | BTB/POZ |
IPR007087 | 398 | 419 | PF00096 | Zinc finger | |
IPR007087 | 425 | 447 | PF00096 | Zinc finger | |
IPR007087 | 453 | 475 | PF00096 | Zinc finger | |
HMMSmart | IPR000210 | 58 | 152 | SM00225 | BTB/POZ-like |
IPR015880 | 398 | 419 | SM00355 | Zinc finger | |
IPR015880 | 425 | 447 | SM00355 | Zinc finger | |
IPR015880 | 453 | 473 | SM00355 | Zinc finger | |
ProfileScan | IPR000210 | 58 | 122 | PS50097 | BTB/POZ-like |
IPR007087 | 398 | 424 | PS50157 | Zinc finger | |
IPR007087 | 425 | 452 | PS50157 | Zinc finger | |
IPR007087 | 453 | 482 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 427 | 447 | PS00028 | Zinc finger |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 4 | IFGLEFVLIFLSLVAPNKICDEM | 26 | PRIMARY | 23 |
---|
![]() |
---|
Primer_f | CATGGGGATTGAAGAAAAACC |
---|---|
Primer_r | CACGTCAATGGCCTACAAACC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CATGGGGATTGAAGAAAAACC |
Primer_r | CACGTCAATGGCCTACAAACC |
PCR product length | 102 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |