Order Kazusa clone(s) from : ![]() |
Product ID | ORK00537 |
---|---|
Accession No | AB007901 |
Description | zinc finger and BTB domain containing 24, transcript variant 1 |
Clone name | hh00601s1 |
Vector information | |
cDNA sequence | DNA sequence (5597 bp) Predicted protein sequence (702 aa) |
HaloTag ORF Clone |
FHC00537
![]() |
Flexi ORF Clone | FXC00537 |
Source | Human adult brain |
Rouge ID |
mKIAA0441
by Kazusa Mouse cDNA Project
|
Note | We replaced hh00601, former representative clones for KIAA0441 with hh00601s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3335 bp |
---|---|
Genome contig ID | gi89161210r_109790412 |
PolyA signal sequence (CATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 6 | r | 109890412 | 109911133 | 7 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR007087 | 300 | 322 | PD000003 | Zinc finger |
IPR007087 | 327 | 350 | PD000003 | Zinc finger | |
IPR007087 | 439 | 461 | PD000003 | Zinc finger | |
HMMPfam | IPR013069 | 32 | 138 | PF00651 | BTB/POZ |
IPR000637 | 164 | 176 | PF02178 | HMG-I and HMG-Y | |
IPR007087 | 299 | 321 | PF00096 | Zinc finger | |
IPR007087 | 327 | 349 | PF00096 | Zinc finger | |
IPR007087 | 355 | 377 | PF00096 | Zinc finger | |
IPR007087 | 383 | 405 | PF00096 | Zinc finger | |
IPR007087 | 411 | 433 | PF00096 | Zinc finger | |
IPR007087 | 439 | 461 | PF00096 | Zinc finger | |
IPR007087 | 467 | 489 | PF00096 | Zinc finger | |
IPR007087 | 495 | 517 | PF00096 | Zinc finger | |
HMMSmart | IPR000210 | 42 | 138 | SM00225 | BTB/POZ-like |
IPR015880 | 299 | 321 | SM00355 | Zinc finger | |
IPR015880 | 327 | 349 | SM00355 | Zinc finger | |
IPR015880 | 355 | 377 | SM00355 | Zinc finger | |
IPR015880 | 383 | 405 | SM00355 | Zinc finger | |
IPR015880 | 411 | 433 | SM00355 | Zinc finger | |
IPR015880 | 439 | 461 | SM00355 | Zinc finger | |
IPR015880 | 467 | 489 | SM00355 | Zinc finger | |
IPR015880 | 495 | 517 | SM00355 | Zinc finger | |
ProfileScan | IPR000210 | 42 | 108 | PS50097 | BTB/POZ-like |
IPR007087 | 299 | 326 | PS50157 | Zinc finger | |
IPR007087 | 327 | 354 | PS50157 | Zinc finger | |
IPR007087 | 355 | 382 | PS50157 | Zinc finger | |
IPR007087 | 383 | 410 | PS50157 | Zinc finger | |
IPR007087 | 411 | 438 | PS50157 | Zinc finger | |
IPR007087 | 439 | 466 | PS50157 | Zinc finger | |
IPR007087 | 467 | 494 | PS50157 | Zinc finger | |
IPR007087 | 495 | 522 | PS50157 | Zinc finger | |
ScanRegExp | IPR007087 | 301 | 321 | PS00028 | Zinc finger |
IPR007087 | 329 | 349 | PS00028 | Zinc finger | |
IPR007087 | 357 | 377 | PS00028 | Zinc finger | |
IPR007087 | 385 | 405 | PS00028 | Zinc finger | |
IPR007087 | 413 | 433 | PS00028 | Zinc finger | |
IPR007087 | 441 | 461 | PS00028 | Zinc finger | |
IPR007087 | 469 | 489 | PS00028 | Zinc finger | |
IPR007087 | 497 | 517 | PS00028 | Zinc finger |
![]() |
---|
Primer_f | TTCAAGAAGCACTGGGCAAGC |
---|---|
Primer_r | TAGAATGTTATGCTTTGGGGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TTCAAGAAGCACTGGGCAAGC |
Primer_r | TAGAATGTTATGCTTTGGGGC |
PCR product length | 152 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |