KIAA1917

Product ID	ORK00950
Accession No	AB067504
Description	ring finger protein 157
Clone name	fk00028
Vector information	vector_info#126 The cDNA fragment was inserted at the NotI-S ... vector_info#126 The cDNA fragment was inserted at the NotI-SalI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was ligated at the NotI site and the 3' end of the cDNA was inserted at the SalI site of the vector. The adjacent sequences to the cDNA are as follows: AACCCTCACT AAAGGGAACA AAAGCTGGAG CTCCACCGCG GTG-5' end of cDNA, GGGCCCCCCC TCGAGGTCGA CCCACGCGTC CGCTTTTTTT TTTTTTTT-3' end of cDNA.
cDNA sequence	DNA sequence (3570 bp) Predicted protein sequence (702 aa)
HaloTag ORF Clone	FHC00950
Flexi ORF Clone	FXC00950
Source	Human fetal brain
Rouge ID	mKIAA1917 by Kazusa Mouse cDNA Project
Note	We replaced hj00666, former representative clones for KIAA1917 with fk00028. (2002/5/10)

Length: 3570 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	1461 bp
Genome contig ID	gi51511734r_71551583
PolyA signal sequence (None)	+--------+--------+----*----+---- TACAAGATTGAAAAGATCGAAACTCTGTCTCAAAC
Flanking genome sequence (99868 - 99819)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAATTCAAGGCTGTTTCCAAGGCAGCCTCAAAAAGAGCCT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	r	71651451	71747985	19	99.5	Perfect prediction

Length: 702 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q96PX1	100.0	RING finger pro...	Homo sapiens
EAW89378	99.9	ring finger pro...	Homo sapiens
XP_001097963	96.5	similar to ring...	Macaca mulatta
XP_584356	92.4	similar to ring...	Bos taurus
CAM16808	92.5	ring finger pro...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011116	5.1e-58	57.4	KIAA0544

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	300	338	PF00097	Zinc finger
HMMSmart	IPR001841	300	338	SM00184	Zinc finger
ProfileScan	IPR001841	300	339	PS50089	Zinc finger

Primer_f	AGGCCAGTAAAGCTAAAGTCC
Primer_r	AGGCTGTTGTCTTTGGGAATG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	genbank
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-