Order Kazusa clone(s) from : ![]() |
Product ID | ORK00894 |
---|---|
Accession No | AB051498 |
Description | zinc finger, CCHC domain containing 6 |
Clone name | fj18750 |
Vector information | |
cDNA sequence | DNA sequence (3992 bp) Predicted protein sequence (1090 aa) |
Flexi ORF Clone |
FXC00894
![]() |
Source | Human fetal brain |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 718 bp |
---|---|
Genome contig ID | gi89161216r_87992694 |
PolyA signal sequence (AATAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 9 | r | 88092694 | 88143678 | 19 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001878 | 1046 | 1055 | PR00939 | Zinc finger |
IPR001878 | 1055 | 1063 | PR00939 | Zinc finger | |
HMMPfam | IPR002058 | 145 | 198 | PF03828 | PAP/25A-associated |
IPR001878 | 558 | 575 | PF00098 | Zinc finger | |
IPR002934 | 621 | 709 | PF01909 | DNA polymerase | |
IPR002058 | 828 | 881 | PF03828 | PAP/25A-associated | |
IPR001878 | 940 | 957 | PF00098 | Zinc finger | |
IPR001878 | 1046 | 1063 | PF00098 | Zinc finger | |
HMMSmart | IPR001878 | 559 | 575 | SM00343 | Zinc finger |
IPR001878 | 941 | 957 | SM00343 | Zinc finger | |
IPR001878 | 1047 | 1063 | SM00343 | Zinc finger | |
ProfileScan | IPR001878 | 560 | 575 | PS50158 | Zinc finger |
IPR001878 | 942 | 956 | PS50158 | Zinc finger | |
IPR001878 | 1047 | 1063 | PS50158 | Zinc finger |
![]() |
Primer_f | TAACTATGGACCGGTATTCAG |
---|---|
Primer_r | TGCTTTCACACCAGGATTCAG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | TAACTATGGACCGGTATTCAG |
Primer_r | TGCTTTCACACCAGGATTCAG |
PCR product length | 181 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |