KIAA1711

Product ID	ORK00894
Accession No	AB051498
Description	zinc finger, CCHC domain containing 6
Clone name	fj18750
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (3992 bp) Predicted protein sequence (1090 aa)
Flexi ORF Clone	FXC00894
Source	Human fetal brain

Length: 3992 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	718 bp
Genome contig ID	gi89161216r_87992694
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- ATTTTCAAAGGAAAAATAAAATGAAAGTACTTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTTTTATGATACTCAGAAATTAGGATGAAGAACTTTTAAAATTGCTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	88092694	88143678	19	99.8	Perfect prediction

Length: 1090 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW62714	100.0	zinc finger, CC...	Homo sapiens
Q5VYS8	100.0	Zinc finger CCH...	Homo sapiens
CAI45944	99.7	hypothetical pr...	Homo sapiens
XP_001138296	99.5	hypothetical pr...	Pan troglodytes
XP_001138453	95.5	hypothetical pr...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D83776	2.7e-76	45.1	KIAA0191

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001878	1046	1055	PR00939	Zinc finger
FPrintScan	IPR001878	1055	1063	PR00939	Zinc finger
HMMPfam	IPR002058	145	198	PF03828	PAP/25A-associated
	IPR001878	558	575	PF00098	Zinc finger
	IPR002934	621	709	PF01909	DNA polymerase
	IPR002058	828	881	PF03828	PAP/25A-associated
	IPR001878	940	957	PF00098	Zinc finger
	IPR001878	1046	1063	PF00098	Zinc finger
HMMSmart	IPR001878	559	575	SM00343	Zinc finger
	IPR001878	941	957	SM00343	Zinc finger
	IPR001878	1047	1063	SM00343	Zinc finger
ProfileScan	IPR001878	560	575	PS50158	Zinc finger
	IPR001878	942	956	PS50158	Zinc finger
	IPR001878	1047	1063	PS50158	Zinc finger

Primer_f	TAACTATGGACCGGTATTCAG
Primer_r	TGCTTTCACACCAGGATTCAG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	CCR
Primer_f	TAACTATGGACCGGTATTCAG
Primer_r	TGCTTTCACACCAGGATTCAG
PCR product length	181 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles