Order Kazusa clone(s) from : ![]() |
Product ID | ORK07406 |
---|---|
Accession No | D83776 |
Description | zinc finger, CCHC domain containing 11 |
Clone name | ha02719 |
Vector information | |
cDNA sequence | DNA sequence (5203 bp) Predicted protein sequence (1516 aa) |
Source | Myeloblast cell line (KG-1) |
Rouge ID |
mKIAA0191
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 650 bp |
---|---|
Genome contig ID | gi89161185r_52561545 |
PolyA signal sequence (AATAAA,-16) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | r | 52661545 | 52764158 | 29 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002058 | 500 | 553 | PF03828 | PAP/25A-associated |
IPR001878 | 785 | 802 | PF00098 | Zinc finger | |
IPR002934 | 848 | 937 | PF01909 | DNA polymerase | |
IPR002058 | 1056 | 1109 | PF03828 | PAP/25A-associated | |
IPR001878 | 1165 | 1182 | PF00098 | Zinc finger | |
IPR001878 | 1229 | 1246 | PF00098 | Zinc finger | |
HMMSmart | IPR001878 | 786 | 802 | SM00343 | Zinc finger |
IPR001878 | 1166 | 1182 | SM00343 | Zinc finger | |
IPR001878 | 1230 | 1246 | SM00343 | Zinc finger | |
ProfileScan | IPR001878 | 787 | 802 | PS50158 | Zinc finger |
IPR001878 | 1167 | 1182 | PS50158 | Zinc finger | |
IPR001878 | 1230 | 1246 | PS50158 | Zinc finger | |
ScanRegExp | IPR007087 | 178 | 200 | PS00028 | Zinc finger |
Panel name | Genebridge 4 |
---|---|
Primer_f | CACCAAAGTCACCTAATTCAG |
Primer_r | GTCCCTTTTCTGCTTCTGCTG |
PCR product length | 99 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |