KIAA0191

Product ID	ORK07406
Accession No	D83776
Description	zinc finger, CCHC domain containing 11
Clone name	ha02719
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5203 bp) Predicted protein sequence (1516 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0191 by Kazusa Mouse cDNA Project

Length: 5203 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	650 bp
Genome contig ID	gi89161185r_52561545
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- AGTACTTCTATTTTAAGTTAATAAATCTTTTTGAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAGAGTTAAATTTGGTTAAACTGTTGTATAGATGATGGAAATATTACGTA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	52661545	52764158	29	100.0	Perfect prediction

Length: 1516 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5TAX3	100.0	Zinc finger CCH...	Homo sapiens
AAI31735	99.9	Zinc finger, CC...	Homo sapiens
NP_001009882	99.7	zinc finger, CC...	Homo sapiens
XP_001111993	98.4	similar to zinc...	Macaca mulatta
XP_513410	98.1	zinc finger, CC...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051498	1.7e-53	45.3	KIAA1711

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002058	500	553	PF03828	PAP/25A-associated
	IPR001878	785	802	PF00098	Zinc finger
	IPR002934	848	937	PF01909	DNA polymerase
	IPR002058	1056	1109	PF03828	PAP/25A-associated
	IPR001878	1165	1182	PF00098	Zinc finger
	IPR001878	1229	1246	PF00098	Zinc finger
HMMSmart	IPR001878	786	802	SM00343	Zinc finger
	IPR001878	1166	1182	SM00343	Zinc finger
	IPR001878	1230	1246	SM00343	Zinc finger
ProfileScan	IPR001878	787	802	PS50158	Zinc finger
	IPR001878	1167	1182	PS50158	Zinc finger
	IPR001878	1230	1246	PS50158	Zinc finger
ScanRegExp	IPR007087	178	200	PS00028	Zinc finger

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CACCAAAGTCACCTAATTCAG
Primer_r	GTCCCTTTTCTGCTTCTGCTG
PCR product length	99 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles