KIAA1842

Product ID	ORK05568
Accession No	AB058745
Description	kelch repeat and BTB (POZ) domain containing 8
Clone name	fj22905s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pYO326 vector. The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. pYO326 shuttle vector, pYO326 (Amp-r) was kindly provided by Y. Ohya (University of Tokyo).
cDNA sequence	DNA sequence (4403 bp) Predicted protein sequence (526 aa)
Source	Human fetal brain
Rouge ID	mKIAA1842 by Kazusa Mouse cDNA Project
Note	We replaced fj22905, former representative clones for KIAA1842 with fj22905s1. (2002/5/10)

Length: 4403 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2821 bp
Genome contig ID	gi89161205f_67036307
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- GTCATTGTTTCTTATAATAAAACCTTTTCTGATTG
Flanking genome sequence (108015 - 108064)	----+--------+--------+--------+--------+----* AAAACTTCCAGTGTTGCAAAGTGATATCTGACTAGTGAGTGTTGCAGAAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	67136306	67144320	2	99.0	Perfect prediction

Length: 526 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAM43839	100.0	T-cell activati...	Homo sapiens
Q8NFY9	100.0	Kelch repeat an...	Homo sapiens
XP_001087631	98.3	similar to T-ce...	Macaca mulatta
XP_608990	98.1	kelch repeat an...	Bos taurus
EDL91413	97.9	similar to T-ce...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040922	2.3e-32	31.6	KIAA1489
D50922	1e-24	28.3	KIAA0132
AB051474	1.7e-24	26.3	KIAA1687
AB040923	3.7e-23	26.3	KIAA1490
AB037799	1.3e-22	25.8	KIAA1378

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013069	1	72	PF00651	BTB/POZ
	IPR011705	77	179	PF07707	BTB/Kelch-associated
	IPR006652	256	302	PF01344	Kelch repeat type 1
	IPR006652	304	353	PF01344	Kelch repeat type 1
	IPR006652	395	441	PF01344	Kelch repeat type 1
HMMSmart	IPR006652	261	315	SM00612	Kelch repeat type 1
	IPR006652	316	366	SM00612	Kelch repeat type 1
	IPR006652	407	457	SM00612	Kelch repeat type 1
ProfileScan	IPR000210	1	42	PS50097	BTB/POZ-like

Primer_f	TGGTCTGAGCCTATGCCTATC
Primer_r	TGGAAGAGAAGGTTGGGCTAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-