Order Kazusa clone(s) from : ![]() |
Product ID | ORK05560 |
---|---|
Accession No | AB037801 |
Description | jumonji domain containing 1C |
Clone name | fj05118 |
Vector information | |
cDNA sequence | DNA sequence (4614 bp) Predicted protein sequence (1265 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1380
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 815 bp |
---|---|
Genome contig ID | gi89161187r_64496996 |
PolyA signal sequence (ATTAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 10 | r | 64596996 | 64637613 | 17 | 99.6 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013129 | 1107 | 1206 | PF02373 | Transcription factor jumonji |
HMMSmart | IPR003347 | 999 | 1223 | SM00558 | Transcription factor jumonji/aspartyl beta-hydroxylase |
ProfileScan | IPR003347 | 999 | 1223 | PS51184 | Transcription factor jumonji/aspartyl beta-hydroxylase |
![]() |
Primer_f | TGAAATACCTGGTGCTCTGTG |
---|---|
Primer_r | ACTCCATATTCTTCAAGCAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |