Order Kazusa clone(s) from : ![]() |
Product ID | ORK01605 |
---|---|
Accession No | AB018285 |
Description | lysine (K)-specific demethylase 3A, transcript variant 1 |
Clone name | hk04073s2 |
Vector information | |
cDNA sequence | DNA sequence (4652 bp) Predicted protein sequence (1338 aa) |
HaloTag ORF Clone |
FHC01605
![]() |
Flexi ORF Clone | FXC01605 |
Source | Human adult brain |
Rouge ID |
mKIAA0742
by Kazusa Mouse cDNA Project
|
Note | We replaced hk04073s1 and hk04073, former representative clones for KIAA0742 with hk04073s2. (2013/5/10,2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013129 | 1168 | 1281 | PF02373 | Transcription factor jumonji |
HMMSmart | IPR003347 | 1075 | 1298 | SM00558 | Transcription factor jumonji/aspartyl beta-hydroxylase |
ProfileScan | IPR003347 | 1075 | 1298 | PS51184 | Transcription factor jumonji/aspartyl beta-hydroxylase |
![]() |
Primer_f | ACCTCGTATCAGCTCTGGAAC |
---|---|
Primer_r | CTGTCACTTCCTCCATTGCTC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ACCTCGTATCAGCTCTGGAAC |
Primer_r | CTGTCACTTCCTCCATTGCTC |
PCR product length | 172 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |