Order Kazusa clone(s) from : ![]() |
Product ID | ORK05559 |
---|---|
Accession No | AB029005 |
Description | lysine (K)-specific demethylase 3B |
Clone name | fg06837 |
Vector information | |
cDNA sequence | DNA sequence (6691 bp) Predicted protein sequence (1787 aa) |
HaloTag ORF Clone |
FHC05559
![]() |
Flexi ORF Clone | FXC05559 |
Source | Human fetal brain |
Rouge ID |
mKIAA1082
by Kazusa Mouse cDNA Project
|
Note | We replaced hj07386, former representative clones for KIAA1082 with fg06837. (2001/5/29) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1325 bp |
---|---|
Genome contig ID | gi51511721f_137616400 |
PolyA signal sequence (ATTAAA,-21) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (184217 - 184266) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 5 | f | 137716304 | 137800615 | 24 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013129 | 1619 | 1730 | PF02373 | Transcription factor jumonji |
HMMSmart | IPR003347 | 1524 | 1747 | SM00558 | Transcription factor jumonji/aspartyl beta-hydroxylase |
ProfileScan | IPR003347 | 1524 | 1747 | PS51184 | Transcription factor jumonji/aspartyl beta-hydroxylase |
![]() |
Primer_f | TCCCATCTTAGTCTTACCTTG |
---|---|
Primer_r | GAAACATTAAGAGGAGTCCCC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TCCCATCTTAGTCTTACCTTG |
Primer_r | GAAACATTAAGAGGAGTCCCC |
PCR product length | 158 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |