KIAA1233

Product ID	ORK04047
Accession No	AB033059
Description	ADAMTS-like 3
Clone name	fh08611
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5107 bp) Predicted protein sequence (1023 aa)
Source	Human fetal brain
Rouge ID	mKIAA1233 by Kazusa Mouse cDNA Project

Length: 5107 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2033 bp
Genome contig ID	gi51511731f_82283675
PolyA signal sequence (None)	+--------+--------+----*----+---- ATAAATTTACTTTGATTATTCAGTGGCATCCTTAT
Flanking genome sequence (215922 - 215971)	----+--------+--------+--------+--------+----* AAATGTAGGCAGCTTATGTGTGTTATTTTTTGGTAGCCTTCGGTCTTGTC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	82383675	82499595	14	99.4	Perfect prediction

Length: 1023 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
NP_997400	100.0	ADAMTS-like 3 p...	Homo sapiens
P82987	100.0	ADAMTS-like pro...	Homo sapiens
EAW62418	100.0	ADAMTS-like 3 [...	Homo sapiens
AAI28390	99.8	ADAMTS-like 3 [...	Homo sapiens
XP_523141	98.9	ADAMTS-like 3 [...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011177	1.2e-18	32.4	KIAA0605
AB095949	3.1e-09	36.6	KIAA2029
AB002364	3.7e-08	32.8	KIAA0366
AB018305	4.5e-08	26.3	KIAA0762
AB037733	2e-07	23.1	KIAA1312

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000884	42	91	PF00090	Thrombospondin
	IPR000884	98	133	PF00090	Thrombospondin
	IPR000884	158	185	PF00090	Thrombospondin
	IPR013151	259	316	PF00047	Immunoglobulin
	IPR013151	540	597	PF00047	Immunoglobulin
	IPR013098	631	716	PF07679	Immunoglobulin I-set
	IPR000884	760	815	PF00090	Thrombospondin
	IPR000884	821	843	PF00090	Thrombospondin
	IPR000884	933	987	PF00090	Thrombospondin
	IPR010909	990	1022	PF08686	PLAC
HMMSmart	IPR000884	38	92	SM00209	Thrombospondin
	IPR000884	94	152	SM00209	Thrombospondin
	IPR000884	154	213	SM00209	Thrombospondin
	IPR003599	251	328	SM00409	Immunoglobulin subtype
	IPR003598	257	321	SM00408	Immunoglobulin subtype 2
	IPR003599	532	622	SM00409	Immunoglobulin subtype
	IPR003598	538	602	SM00408	Immunoglobulin subtype 2
	IPR003599	638	717	SM00409	Immunoglobulin subtype
	IPR003598	644	706	SM00408	Immunoglobulin subtype 2
	IPR000884	759	816	SM00209	Thrombospondin
	IPR000884	818	877	SM00209	Thrombospondin
	IPR000884	932	976	SM00209	Thrombospondin
ProfileScan	IPR000884	35	92	PS50092	Thrombospondin
	IPR000884	95	150	PS50092	Thrombospondin
	IPR000884	151	213	PS50092	Thrombospondin
	IPR007110	228	324	PS50835	Immunoglobulin-like
	IPR007110	517	611	PS50835	Immunoglobulin-like
	IPR007110	628	710	PS50835	Immunoglobulin-like
	IPR000884	756	814	PS50092	Thrombospondin
	IPR000884	815	877	PS50092	Thrombospondin
	IPR000884	929	976	PS50092	Thrombospondin
	IPR010909	987	1023	PS50900	PLAC

Primer_f	TGGCTTTGGATGTGTCTGTGG
Primer_r	GTGCTCAACCCAGTGTCAGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	unigene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-