Order Kazusa clone(s) from : ![]() |
Product ID | ORK06967 |
---|---|
Accession No | AB018305 |
Description | spondin 1, extracellular matrix protein |
Clone name | hk04668s1 |
Vector information | |
cDNA sequence | DNA sequence (4301 bp) Predicted protein sequence (724 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0762
by Kazusa Mouse cDNA Project
|
Note | We replaced hk04668, former representative clones for KIAA0762 with hk04668s1. (2002/5/10) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 2124 bp |
---|---|
Genome contig ID | gi51511727f_13860979 |
PolyA signal sequence (AATAAA,-26) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (384956 - 385005) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 11 | f | 13960979 | 14245933 | 15 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002861 | 1 | 90 | PF02014 | Reeler region |
IPR009465 | 91 | 332 | PF06468 | Spondin | |
IPR000884 | 363 | 411 | PF00090 | Thrombospondin | |
IPR000884 | 422 | 471 | PF00090 | Thrombospondin | |
IPR000884 | 479 | 527 | PF00090 | Thrombospondin | |
IPR000884 | 535 | 582 | PF00090 | Thrombospondin | |
IPR000884 | 589 | 637 | PF00090 | Thrombospondin | |
IPR000884 | 675 | 724 | PF00090 | Thrombospondin | |
HMMSmart | IPR000884 | 362 | 412 | SM00209 | Thrombospondin |
IPR000884 | 421 | 472 | SM00209 | Thrombospondin | |
IPR000884 | 478 | 528 | SM00209 | Thrombospondin | |
IPR000884 | 534 | 583 | SM00209 | Thrombospondin | |
IPR000884 | 588 | 638 | SM00209 | Thrombospondin | |
IPR000884 | 674 | 723 | SM00209 | Thrombospondin | |
ProfileScan | IPR002861 | 1 | 111 | PS51019 | Reeler region |
IPR009465 | 112 | 305 | PS51020 | Spondin | |
IPR000884 | 359 | 412 | PS50092 | Thrombospondin | |
IPR000884 | 418 | 472 | PS50092 | Thrombospondin | |
IPR000884 | 475 | 528 | PS50092 | Thrombospondin | |
IPR000884 | 531 | 583 | PS50092 | Thrombospondin | |
IPR000884 | 585 | 638 | PS50092 | Thrombospondin | |
IPR000884 | 671 | 723 | PS50092 | Thrombospondin |
![]() |
Primer_f | GCAATGTTGTTCTAAGCTATC |
---|---|
Primer_r | AACAATCCAACAAGAGTCATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GCAATGTTGTTCTAAGCTATC |
Primer_r | AACAATCCAACAAGAGTCATG |
PCR product length | 202 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |