Order Kazusa clone(s) from : ![]() |
Product ID | ORK04046 |
---|---|
Accession No | AB037733 |
Description | ADAM metallopeptidase with thrombospondin type 1 motif, 9 |
Clone name | fh11767 |
Vector information | |
cDNA sequence | DNA sequence (5139 bp) Predicted protein sequence (1471 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1312
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 722 bp |
---|---|
Genome contig ID | gi89161205r_64410865 |
PolyA signal sequence (AATAAA,-20) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | r | 64510865 | 64647326 | 30 | 99.8 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR013273 | 439 | 457 | PR01857 | Peptidase M12B |
IPR013273 | 555 | 574 | PR01857 | Peptidase M12B | |
IPR013273 | 575 | 594 | PR01857 | Peptidase M12B | |
HMMPfam | IPR002870 | 5 | 49 | PF01562 | Peptidase M12B |
IPR001590 | 135 | 341 | PF01421 | Peptidase M12B | |
IPR000884 | 434 | 484 | PF00090 | Thrombospondin | |
IPR010294 | 595 | 713 | PF05986 | ADAM-TS Spacer 1 | |
IPR000884 | 841 | 895 | PF00090 | Thrombospondin | |
IPR000884 | 898 | 950 | PF00090 | Thrombospondin | |
IPR000884 | 953 | 976 | PF00090 | Thrombospondin | |
IPR000884 | 1026 | 1051 | PF00090 | Thrombospondin | |
IPR000884 | 1089 | 1137 | PF00090 | Thrombospondin | |
IPR000884 | 1174 | 1225 | PF00090 | Thrombospondin | |
IPR000884 | 1228 | 1281 | PF00090 | Thrombospondin | |
IPR000884 | 1287 | 1322 | PF00090 | Thrombospondin | |
IPR000884 | 1346 | 1367 | PF00090 | Thrombospondin | |
IPR000884 | 1404 | 1454 | PF00090 | Thrombospondin | |
HMMSmart | IPR000884 | 433 | 485 | SM00209 | Thrombospondin |
IPR000884 | 723 | 778 | SM00209 | Thrombospondin | |
IPR000884 | 780 | 828 | SM00209 | Thrombospondin | |
IPR000884 | 842 | 896 | SM00209 | Thrombospondin | |
IPR000884 | 897 | 946 | SM00209 | Thrombospondin | |
IPR000884 | 952 | 1008 | SM00209 | Thrombospondin | |
IPR000884 | 1028 | 1082 | SM00209 | Thrombospondin | |
IPR000884 | 1084 | 1138 | SM00209 | Thrombospondin | |
IPR000884 | 1174 | 1226 | SM00209 | Thrombospondin | |
IPR000884 | 1227 | 1282 | SM00209 | Thrombospondin | |
IPR000884 | 1286 | 1341 | SM00209 | Thrombospondin | |
IPR000884 | 1343 | 1397 | SM00209 | Thrombospondin | |
IPR000884 | 1400 | 1455 | SM00209 | Thrombospondin | |
ProfileScan | IPR001590 | 135 | 341 | PS50215 | Peptidase M12B |
IPR000884 | 430 | 485 | PS50092 | Thrombospondin | |
IPR000884 | 720 | 778 | PS50092 | Thrombospondin | |
IPR000884 | 839 | 896 | PS50092 | Thrombospondin | |
IPR000884 | 897 | 946 | PS50092 | Thrombospondin | |
IPR000884 | 949 | 1008 | PS50092 | Thrombospondin | |
IPR000884 | 1024 | 1082 | PS50092 | Thrombospondin | |
IPR000884 | 1083 | 1138 | PS50092 | Thrombospondin | |
IPR000884 | 1170 | 1221 | PS50092 | Thrombospondin | |
IPR000884 | 1224 | 1282 | PS50092 | Thrombospondin | |
IPR000884 | 1283 | 1336 | PS50092 | Thrombospondin | |
IPR000884 | 1339 | 1397 | PS50092 | Thrombospondin | |
IPR000884 | 1398 | 1455 | PS50092 | Thrombospondin | |
ScanRegExp | IPR006025 | 273 | 282 | PS00142 | Peptidase M |
![]() |
Primer_f | GTAACCATCGTCAGCTCAGCC |
---|---|
Primer_r | CAGTTCACAGTGGCAAATCGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | GTAACCATCGTCAGCTCAGCC |
Primer_r | CAGTTCACAGTGGCAAATCGG |
PCR product length | 113 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |