Order Kazusa clone(s) from : ![]() |
Product ID | ORK04186 |
---|---|
Accession No | AB032972 |
Description | ankyrin repeat and SOCS box containing 1 |
Clone name | hg00368 |
Vector information | |
cDNA sequence | DNA sequence (6518 bp) Predicted protein sequence (271 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA1146
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 5702 bp |
---|---|
Genome contig ID | gi89161199f_238909092 |
PolyA signal sequence (AATAAA,-28) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (116539 - 116588) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 239009092 | 239025629 | 4 | 99.1 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002110 | 14 | 26 | PR01415 | Ankyrin |
IPR002110 | 59 | 71 | PR01415 | Ankyrin | |
HMMPfam | IPR002110 | 15 | 45 | PF00023 | Ankyrin |
IPR002110 | 46 | 74 | PF00023 | Ankyrin | |
IPR002110 | 79 | 111 | PF00023 | Ankyrin | |
IPR002110 | 131 | 159 | PF00023 | Ankyrin | |
IPR002110 | 176 | 204 | PF00023 | Ankyrin | |
IPR001496 | 232 | 271 | PF07525 | SOCS protein | |
HMMSmart | IPR002110 | 13 | 42 | SM00248 | Ankyrin |
IPR002110 | 46 | 75 | SM00248 | Ankyrin | |
IPR002110 | 79 | 108 | SM00248 | Ankyrin | |
IPR002110 | 131 | 156 | SM00248 | Ankyrin | |
ProfileScan | IPR002110 | 16 | 45 | PS50088 | Ankyrin |
IPR002110 | 16 | 159 | PS50297 | Ankyrin | |
IPR002110 | 46 | 78 | PS50088 | Ankyrin | |
IPR002110 | 79 | 111 | PS50088 | Ankyrin | |
IPR001496 | 229 | 271 | PS50225 | SOCS protein |
![]() |
Primer_f | TTCATTCCAGGTTCATCCCAC |
---|---|
Primer_r | TGATGGAGACTGTGGGCAAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGATGGAGACTGTGGGCAAGC |
Primer_r | TTCATTCCAGGTTCATCCCAC |
PCR product length | 110 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |