KIAA0396

Product ID	ORK01595
Accession No	AB007856
Description	fem-1 homolog b (C. elegans)
Clone name	hg00180s1
Vector information	The cDNA fragment was originally inserted at SalI-NotI site ... The cDNA fragment was originally inserted at SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) and a RT-PCR product (1-139) was subcloned upstream of the cDNA (140-6497). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CCCACGCGT-5' end of cDNA.
cDNA sequence	DNA sequence (6497 bp) Predicted protein sequence (627 aa)
HaloTag ORF Clone	FHC01595
Flexi ORF Clone	FXC01595
Source	Human adult brain
Rouge ID	mKIAA0396 by Kazusa Mouse cDNA Project
Note	We replaced hg00180, former representative clones for KIAA0396 with hg00180s1. (2002/5/10)

Length: 6497 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4613 bp
Genome contig ID	gi51511731f_66257810
PolyA signal sequence (AGTAAA,-12)	+--------+--------+----*----+---- AGGAAAAAATGGTGTTTGTGTTCAGTAAATGTTTG
Flanking genome sequence (117439 - 117488)	----+--------+--------+--------+--------+----* AAAAAAACTACTTTGAGGTTTGTGTCTTTATTAATTATTCAGTGTGCCTT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	15	f	66357810	66375247	2	99.0	Perfect prediction

Length: 627 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_001496275	99.7	fem-1 homolog b...	Equus caballus
XP_592679	99.5	similar to fem-...	Bos taurus
P0C6P7	99.2	Protein fem-1 h...	Rattus norvegicus
Q9Z2G0	99.0	Protein fem-1 h...	Mus musculus
BAE21305	98.9	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058688	3.3e-75	40.7	KIAA1785
AB046856	1.9e-13	34.0	KIAA1636
D86982	2.3e-13	31.2	KIAA0229
AB051515	1.3e-12	30.3	KIAA1728
AB058779	5.3e-12	31.6	KIAA1876

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	46	58	PR01415	Ankyrin
FPrintScan	IPR002110	100	112	PR01415	Ankyrin
HMMPfam	IPR002110	45	77	PF00023	Ankyrin
	IPR002110	87	119	PF00023	Ankyrin
	IPR002110	120	152	PF00023	Ankyrin
	IPR002110	153	185	PF00023	Ankyrin
	IPR002110	186	211	PF00023	Ankyrin
	IPR002110	218	249	PF00023	Ankyrin
	IPR002110	483	530	PF00023	Ankyrin
	IPR002110	531	571	PF00023	Ankyrin
HMMSmart	IPR002110	45	74	SM00248	Ankyrin
	IPR002110	87	116	SM00248	Ankyrin
	IPR002110	120	149	SM00248	Ankyrin
	IPR002110	153	182	SM00248	Ankyrin
	IPR002110	186	215	SM00248	Ankyrin
	IPR002110	218	246	SM00248	Ankyrin
	IPR002110	483	527	SM00248	Ankyrin
	IPR002110	531	570	SM00248	Ankyrin
ProfileScan	IPR002110	45	68	PS50088	Ankyrin
	IPR002110	45	241	PS50297	Ankyrin
	IPR002110	87	119	PS50088	Ankyrin
	IPR002110	120	152	PS50088	Ankyrin
	IPR002110	153	185	PS50088	Ankyrin
	IPR002110	186	218	PS50088	Ankyrin
	IPR002110	483	530	PS50088	Ankyrin
	IPR002110	483	577	PS50297	Ankyrin

Primer_f	AAATCACTAATGGACCTCTGG
Primer_r	CGGTGATGTCATTCTATTGTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAATCACTAATGGACCTCTGG
Primer_r	CGGTGATGTCATTCTATTGTG
PCR product length	99 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles