Order Kazusa clone(s) from : ![]() |
Product ID | ORK01625 |
---|---|
Accession No | AB029021 |
Description | tripartite motif containing 35, transcript variant 1 |
Clone name | hk07318 |
Vector information | |
cDNA sequence | DNA sequence (4181 bp) Predicted protein sequence (504 aa) |
HaloTag ORF Clone |
FHC01625
![]() |
Flexi ORF Clone | FXC01625 |
Source | Human adult brain |
Rouge ID |
mKIAA1098
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000315 | 120 | 137 | PR01406 | Zinc finger |
IPR000315 | 139 | 153 | PR01406 | Zinc finger | |
IPR003879 | 311 | 328 | PR01407 | Butyrophylin-like | |
IPR003879 | 349 | 373 | PR01407 | Butyrophylin-like | |
IPR003879 | 430 | 454 | PR01407 | Butyrophylin-like | |
HMMPfam | IPR001841 | 32 | 71 | PF00097 | Zinc finger |
IPR000315 | 107 | 148 | PF00643 | Zinc finger | |
IPR003877 | 364 | 495 | PF00622 | SPla/RYanodine receptor SPRY | |
HMMSmart | IPR001841 | 32 | 71 | SM00184 | Zinc finger |
IPR000315 | 107 | 148 | SM00336 | Zinc finger | |
IPR006574 | 312 | 363 | SM00589 | SPRY-associated | |
IPR003877 | 364 | 495 | SM00449 | SPla/RYanodine receptor SPRY | |
ProfileScan | IPR001841 | 32 | 72 | PS50089 | Zinc finger |
IPR000315 | 107 | 148 | PS50119 | Zinc finger | |
IPR001870 | 295 | 498 | PS50188 | B302 | |
ScanRegExp | IPR001841 | 47 | 56 | PS00518 | Zinc finger |
![]() |
Primer_f | TTGGGCGTGGTGAGGATGTTG |
---|---|
Primer_r | CTTTACAGGAGAGGGTCACAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |