Order Kazusa clone(s) from : ![]() |
Product ID | ORK07202 |
---|---|
Accession No | AB020705 |
Description | tripartite motif containing 37, transcript variant 1 |
Clone name | hk09541 |
Vector information | |
cDNA sequence | DNA sequence (4111 bp) Predicted protein sequence (979 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0898
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1171 bp |
---|---|
Genome contig ID | gi51511734r_54330349 |
PolyA signal sequence (AATAAA,-17) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 17 | r | 54430349 | 54538649 | 24 | 100.0 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR000315 | 118 | 135 | PR01406 | Zinc finger |
IPR000315 | 138 | 152 | PR01406 | Zinc finger | |
HMMPfam | IPR000315 | 105 | 147 | PF00643 | Zinc finger |
IPR002083 | 298 | 406 | PF00917 | MATH | |
HMMSmart | IPR000315 | 105 | 147 | SM00336 | Zinc finger |
IPR003649 | 147 | 269 | SM00502 | B-box | |
IPR002083 | 296 | 399 | SM00061 | MATH | |
ProfileScan | IPR001841 | 30 | 70 | PS50089 | Zinc finger |
IPR000315 | 105 | 147 | PS50119 | Zinc finger | |
IPR002083 | 291 | 418 | PS50144 | MATH |
![]() |
Primer_f | AACTTTGCCATTGTGCTCCTG |
---|---|
Primer_r | GCATTCAGCAAGACATCAGAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |