KIAA0904

Product ID	ORK04632
Accession No	AB020711
Description	cyclin-dependent kinase 12
Clone name	ha00554
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5896 bp) Predicted protein sequence (1535 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0904 by Kazusa Mouse cDNA Project
Note	We replaced hk10050, former representative clones for KIAA0904 with ha00554. (2002/5/10)

Length: 5896 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1139 bp
Genome contig ID	gi51511734f_34771540
PolyA signal sequence (None)	+--------+--------+----*----+---- ATTTAGCATATTGTTTACACATATATTTTTATGTC
Flanking genome sequence (170702 - 170751)	----+--------+--------+--------+--------+----* AAAAAAAAAACAAAAACCTTTCAAACAGAGCATTGTGATATTGTCAAAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	17	f	34871540	34942240	14	99.6	Perfect prediction

Length: 1535 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI50266	100.0	CRKRS protein [...	Homo sapiens
EAW60577	99.9	Cdc2-related ki...	Homo sapiens
XP_001088486	98.6	CDC2-related pr...	Macaca mulatta
CAM21268	91.2	Cdc2-related ki...	Mus musculus
EAW60576	99.3	Cdc2-related ki...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058694	4.4e-22	44.3	KIAA1791
AB020641	2.9e-06	33.5	KIAA0834
AB023153	7.9e-06	27.9	KIAA0936
AB028951	2.6e-05	31.2	KIAA1028
AB002322	0.00034	22.3	KIAA0324

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	781	1073	PD000001	Protein kinase
HMMPfam	IPR000719	781	1074	PF00069	Protein kinase
HMMSmart	IPR001245	781	1074	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	781	1074	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	781	1074	PS50011	Protein kinase
ScanRegExp	IPR000719	787	810	PS00107	Protein kinase
ScanRegExp	IPR008271	909	921	PS00108	Serine/threonine protein kinase

Primer_f	CCACCTCCTCTTTTGATTCTC
Primer_r	TGTAACTGGGGGACTTGACTG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CCACCTCCTCTTTTGATTCTC
Primer_r	TGTAACTGGGGGACTTGACTG
PCR product length	126 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles