KIAA0324

Product ID	ORK01067
Accession No	AB002322
Description	serine/arginine repetitive matrix 2
Clone name	ee08846s1
Vector information	The cDNA fragment was inserted at the XhoI-SacI site of the ... The cDNA fragment was inserted at the XhoI-SacI site of the pBC SK+ vector(Cm resistance; http://www.kazusa.or.jp/huge/vectorinfo/pbcskp_s.txt) with sequences including attB1 and attB2 sites (CTCGAGCAGC TGAAGCTTTC ACAAGTTTGT ACAAAAAAGC AGGCTCTTC-5' end of cDNA, GAGCTCTCAC CACTTTGTAC AAGAAAGCTG GGCGGCCGCT TTTTTTTTTT TTTTTTT-3' end of cDNA).
cDNA sequence	DNA sequence (9003 bp) Predicted protein sequence (2800 aa)
Flexi ORF Clone	FXC01067
Source
Rouge ID	mKIAA0324 by Kazusa Mouse cDNA Project
Note	We replaced hg00514, former representative clones for KIAA0324 with ee08846s1. (2005/08/06)

Length: 9003 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	543 bp
Genome contig ID	gi51511732f_2642767
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- AACTTTTTCTGTCAAATAAAAATGAGAAATGCAGG
Flanking genome sequence (118647 - 118696)	----+--------+--------+--------+--------+----* AACTGGGTCTGTAGACTGTTTATTAAAGGTGTGTTAAGGGGGCAGCCACT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	f	2742679	2761412	15	99.3	Perfect prediction

Length: 2800 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG10316	100.0	serine/arginine...	synthetic construct
Q9UQ35	100.0	Serine/arginine...	Homo sapiens
BAA83718	99.9	RNA binding pro...	Homo sapiens
EAW85479	99.6	serine/arginine...	Homo sapiens
EAW85482	85.0	serine/arginine...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058756	4.9e-07	31.9	KIAA1853
AB011108	1.5e-05	28.9	KIAA0536
AB028942	0.00055	30.3	KIAA1019
AB011125	0.00081	24.3	KIAA0553

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR013170	99	143	PF08312	mRNA splicing factor

Primer_f	CAACCTCATGGGGGACAGTAG
Primer_r	GTATCCAGAAGTTCCCAGGGG
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CAACCTCATGGGGGACAGTAG
Primer_r	GTATCCAGAAGTTCCCAGGGG
PCR product length	122 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles