Order Kazusa clone(s) from : ![]() |
Product ID | ORK00136 |
---|---|
Accession No | AB020641 |
Description | cyclin-dependent kinase 14, transcript variant 2 |
Clone name | hj05353 |
Vector information | |
cDNA sequence | DNA sequence (4957 bp) Predicted protein sequence (453 aa) |
HaloTag ORF Clone |
FHC00136
![]() |
Flexi ORF Clone | FXC00136 |
Source | Human adult brain |
Rouge ID |
mKIAA0834
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3457 bp |
---|---|
Genome contig ID | gi89161213f_90076648 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (601194 - 601243) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 90176648 | 90677840 | 14 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 119 | 322 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 119 | 403 | PF00069 | Protein kinase |
HMMSmart | IPR001245 | 119 | 403 | SM00219 | Tyrosine protein kinase |
IPR002290 | 119 | 403 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR000719 | 119 | 403 | PS50011 | Protein kinase |
ScanRegExp | IPR000719 | 125 | 148 | PS00107 | Protein kinase |
IPR001199 | 204 | 211 | PS00191 | Cytochrome b5 | |
IPR008271 | 236 | 248 | PS00108 | Serine/threonine protein kinase |
![]() |
Primer_f | TCATTCCTTTTCCCACAGCAG |
---|---|
Primer_r | CAATCCCCTGTTAGAAAGTAC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | UniGene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |