Order Kazusa clone(s) from : ![]() |
Product ID | ORK04501 |
---|---|
Accession No | AB058694 |
Description | cyclin-dependent kinase 13 |
Clone name | fh26241 |
Vector information | |
cDNA sequence | DNA sequence (4803 bp) Predicted protein sequence (653 aa) |
Source | Human fetal brain |
Rouge ID |
mKIAA1791
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 566 bp |
---|---|
Genome contig ID | gi89161213f_39965786 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (135886 - 135935) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 7 | f | 40065786 | 40101670 | 8 | 99.3 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
Primer_f | GTACTGCTTCATCTCATTCTG |
---|---|
Primer_r | CAGGACTGCAATAGGACCATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |