Order Kazusa clone(s) from : ![]() |
Product ID | ORK01105 |
---|---|
Accession No | AB014519 |
Description | Rho-associated, coiled-coil containing protein kinase 2 |
Clone name | hg04117 |
Vector information | |
cDNA sequence | DNA sequence (6409 bp) Predicted protein sequence (1428 aa) |
HaloTag ORF Clone |
FHC01105
![]() |
Flexi ORF Clone | FXC01105 |
Source | Human adult brain |
Rouge ID |
mKIAA0619
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1788 bp |
---|---|
Genome contig ID | gi89161199r_11139510 |
PolyA signal sequence (None) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (99719 - 99670) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | r | 11239229 | 11402162 | 32 | 99.5 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 132 | 394 | PD000001 | Protein kinase |
HMMPfam | IPR000719 | 132 | 394 | PF00069 | Protein kinase |
IPR000961 | 414 | 459 | PF00433 | Protein kinase | |
IPR000861 | 515 | 599 | PF02185 | HR1-like rho-binding repeat | |
IPR015008 | 1018 | 1086 | PF08912 | Rho Binding | |
IPR001849 | 1191 | 1275 | PF00169 | Pleckstrin-like | |
IPR002219 | 1301 | 1353 | PF00130 | Protein kinase C | |
HMMSmart | IPR001245 | 132 | 388 | SM00219 | Tyrosine protein kinase |
IPR002290 | 132 | 394 | SM00220 | Serine/threonine protein kinase | |
IPR000961 | 397 | 457 | SM00133 | Protein kinase | |
IPR001849 | 1191 | 1391 | SM00233 | Pleckstrin-like | |
IPR002219 | 1301 | 1355 | SM00109 | Protein kinase C | |
ProfileScan | IPR000719 | 132 | 394 | PS50011 | Protein kinase |
IPR001849 | 1190 | 1389 | PS50003 | Pleckstrin-like | |
IPR002219 | 1300 | 1355 | PS50081 | Protein kinase C | |
ScanRegExp | IPR000719 | 138 | 161 | PS00107 | Protein kinase |
IPR008271 | 250 | 262 | PS00108 | Serine/threonine protein kinase |
![]() |
---|
![]() |
Primer_f | AAGTTACAGTTTACGCAGGAC |
---|---|
Primer_r | CTTTACGCTTACCATTGCTGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | AAGTTACAGTTTACGCAGGAC |
Primer_r | CTTTACGCTTACCATTGCTGC |
PCR product length | 99 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |