KIAA0619

Product ID	ORK01105
Accession No	AB014519
Description	Rho-associated, coiled-coil containing protein kinase 2
Clone name	hg04117
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6409 bp) Predicted protein sequence (1428 aa)
HaloTag ORF Clone	FHC01105
Flexi ORF Clone	FXC01105
Source	Human adult brain
Rouge ID	mKIAA0619 by Kazusa Mouse cDNA Project

Length: 6409 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1788 bp
Genome contig ID	gi89161199r_11139510
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGCCTGGGCAGCTGAACAAGACTCCGTCTC
Flanking genome sequence (99719 - 99670)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAGTCATCTAATATTTCGATGAAGGAAATAGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	11239229	11402162	32	99.5	Perfect prediction

Length: 1428 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_525689	99.8	Rho-associated,...	Pan troglodytes
XP_001096931	99.0	Rho-associated,...	Macaca mulatta
O75116	100.0	Rho-associated ...	Homo sapiens
BAA75636	99.9	Rho kinase [Hom...	Homo sapiens
NP_004841	99.9	Rho-associated,...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB032950	1.1e-34	30.0	KIAA1124
AB023182	6.9e-11	40.5	KIAA0965
D86959	7.5e-09	23.4	KIAA0204
AB023190	1.2e-07	38.3	KIAA0973
AB018350	1.2e-07	38.0	KIAA0807

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	132	394	PD000001	Protein kinase
HMMPfam	IPR000719	132	394	PF00069	Protein kinase
	IPR000961	414	459	PF00433	Protein kinase
	IPR000861	515	599	PF02185	HR1-like rho-binding repeat
	IPR015008	1018	1086	PF08912	Rho Binding
	IPR001849	1191	1275	PF00169	Pleckstrin-like
	IPR002219	1301	1353	PF00130	Protein kinase C
HMMSmart	IPR001245	132	388	SM00219	Tyrosine protein kinase
	IPR002290	132	394	SM00220	Serine/threonine protein kinase
	IPR000961	397	457	SM00133	Protein kinase
	IPR001849	1191	1391	SM00233	Pleckstrin-like
	IPR002219	1301	1355	SM00109	Protein kinase C
ProfileScan	IPR000719	132	394	PS50011	Protein kinase
	IPR001849	1190	1389	PS50003	Pleckstrin-like
	IPR002219	1300	1355	PS50081	Protein kinase C
ScanRegExp	IPR000719	138	161	PS00107	Protein kinase
ScanRegExp	IPR008271	250	262	PS00108	Serine/threonine protein kinase

Primer_f	AAGTTACAGTTTACGCAGGAC
Primer_r	CTTTACGCTTACCATTGCTGC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AAGTTACAGTTTACGCAGGAC
Primer_r	CTTTACGCTTACCATTGCTGC
PCR product length	99 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles