Order Kazusa clone(s) from : ![]() |
Product ID | ORK00181 |
---|---|
Accession No | AB032950 |
Description | CDC42 binding protein kinase beta (DMPK-like) |
Clone name | fg05708 |
Vector information | |
cDNA sequence | DNA sequence (6678 bp) Predicted protein sequence (1760 aa) |
HaloTag ORF Clone |
FHC00181
![]() |
Flexi ORF Clone | FXC00181 |
Source | Human fetal brain |
Rouge ID |
mKIAA1124
by Kazusa Mouse cDNA Project
|
Note | We replaced hj05161, former representative clones for KIAA1124 with fg05708. (2001/5/29) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 1319 bp |
---|---|
Genome contig ID | gi51511730r_102368482 |
PolyA signal sequence (AATAAA,-18) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (100000 - 99951) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 14 | r | 102468482 | 102593486 | 37 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 125 | 391 | PD000001 | Protein kinase |
FPrintScan | IPR002219 | 1072 | 1086 | PR00008 | Protein kinase C |
IPR002219 | 1088 | 1097 | PR00008 | Protein kinase C | |
IPR002219 | 1101 | 1112 | PR00008 | Protein kinase C | |
IPR002219 | 1113 | 1125 | PR00008 | Protein kinase C | |
HMMPfam | IPR000719 | 125 | 391 | PF00069 | Protein kinase |
IPR000961 | 409 | 456 | PF00433 | Protein kinase | |
IPR014930 | 927 | 988 | PF08826 | DMPK coiled coil | |
IPR002219 | 1075 | 1127 | PF00130 | Protein kinase C | |
IPR001849 | 1145 | 1263 | PF00169 | Pleckstrin-like | |
IPR001180 | 1290 | 1562 | PF00780 | Citron-like | |
IPR000095 | 1631 | 1645 | PF00786 | PAK-box/P21-Rho-binding | |
HMMSmart | IPR001245 | 125 | 391 | SM00219 | Tyrosine protein kinase |
IPR002290 | 125 | 391 | SM00220 | Serine/threonine protein kinase | |
IPR000961 | 392 | 454 | SM00133 | Protein kinase | |
IPR002219 | 1075 | 1124 | SM00109 | Protein kinase C | |
IPR001849 | 1145 | 1265 | SM00233 | Pleckstrin-like | |
IPR001180 | 1293 | 1568 | SM00036 | Citron-like | |
IPR000095 | 1632 | 1667 | SM00285 | PAK-box/P21-Rho-binding | |
ProfileScan | IPR000719 | 125 | 391 | PS50011 | Protein kinase |
IPR002219 | 1074 | 1124 | PS50081 | Protein kinase C | |
IPR001849 | 1144 | 1263 | PS50003 | Pleckstrin-like | |
IPR000095 | 1632 | 1645 | PS50108 | PAK-box/P21-Rho-binding | |
ScanRegExp | IPR000719 | 131 | 154 | PS00107 | Protein kinase |
IPR008271 | 245 | 257 | PS00108 | Serine/threonine protein kinase | |
IPR002219 | 1075 | 1124 | PS00479 | Protein kinase C |
![]() |
Primer_f | CCGTGATTAGTAGCCCGTATG |
---|---|
Primer_r | CAACATCTGGTACAAAGGGTG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | CCGTGATTAGTAGCCCGTATG |
Primer_r | CAACATCTGGTACAAAGGGTG |
PCR product length | 123 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |