KIAA0570

Product ID	ORK05611
Accession No	AB011142
Description	ubiquitin specific peptidase 34
Clone name	hk03615s2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (11269 bp) Predicted protein sequence (3412 aa)
Source	Human adult brain
Rouge ID	mKIAA0570 by Kazusa Mouse cDNA Project
Note	We replaced hh02365, former representative clones for KIAA0570 with hk03615s2. (2002/5/10)

Length: 11269 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	551 bp
Genome contig ID	gi89161199r_61168190
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- GAATACCTGTGGAGGAAATAAAGCACACTTGATGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAATAATTGTTTTATTTTTATTGACATGACTGATTGATTGATTGCTAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	61268190	61551493	81	99.9	Perfect prediction

Length: 3412 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAE51938	100.0	ubiquitin-speci...	Homo sapiens
EAW99998	100.0	ubiquitin speci...	Homo sapiens
Q70CQ2	100.0	Ubiquitin carbo...	Homo sapiens
XP_855134	98.8	similar to ubiq...	Canis lupus fam...
XP_613697	98.6	similar to ubiq...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018272	0	100.0	KIAA0729
AB028980	3.6e-20	26.0	KIAA1057
AB028986	4.6e-05	24.2	KIAA1063

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	1757	2102	PF00443	Peptidase C19
ProfileScan	IPR001394	1760	2106	PS50235	Peptidase C19
ScanRegExp	IPR001394	1761	1776	PS00972	Peptidase C19
ScanRegExp	IPR001394	2014	2031	PS00973	Peptidase C19

Primer_f	CTATATTCAGTCAGTCACAGG
Primer_r	AGATGAGATTTGGGTGGAGAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	CTATATTCAGTCAGTCACAGG
Primer_r	AGATGAGATTTGGGTGGAGAC
PCR product length	205 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles