KIAA1057

Product ID	ORK07312
Accession No	AB028980
Description	ubiquitin specific peptidase 24
Clone name	hh11838
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5618 bp) Predicted protein sequence (977 aa)
Source	Human adult brain
Rouge ID	mKIAA1057 by Kazusa Mouse cDNA Project

Length: 5618 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2683 bp
Genome contig ID	gi89161185r_55204623
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- AGCTTCTAAGAGTATAAAATAAATTTTTCAAAAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAGTTGGAGTCTTGCCGCCATTCTTCATATATCAGAACACAGCCGTAGT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	55304623	55342233	27	99.5	Perfect prediction

Length: 977 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX06658	100.0	hCG33036, isofo...	Homo sapiens
AAI60138	99.9	Ubiquitin speci...	synthetic construct
Q9UPU5	99.9	Ubiquitin carbo...	Homo sapiens
XP_513431	99.8	ubiquitin speci...	Pan troglodytes
XP_001108457	99.5	ubiquitin speci...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011142	9e-28	26.0	KIAA0570
AB040886	4.2e-08	27.8	KIAA1453
D29956	7e-08	24.9	KIAA0055
AB067478	1.9e-05	26.5	KIAA1891
AB023220	0.00029	29.2	KIAA1003

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001394	43	396	PF00443	Peptidase C19
ProfileScan	IPR001394	46	400	PS50235	Peptidase C19
ScanRegExp	IPR001394	47	62	PS00972	Peptidase C19
ScanRegExp	IPR001394	311	328	PS00973	Peptidase C19

Primer_f	CAGATTTGCCAAGTCACAGAG
Primer_r	AACAATGAAGTCTGACAGCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-