Order Kazusa clone(s) from : ![]() |
Product ID | ORK00517 |
---|---|
Accession No | AB002360 |
Description | MCF.2 cell line derived transforming sequence-like |
Clone name | hh00083 |
Vector information | |
cDNA sequence | DNA sequence (5391 bp) Predicted protein sequence (1108 aa) |
HaloTag ORF Clone |
FHC00517
![]() |
Flexi ORF Clone | FXC00517 |
Source | Human adult brain |
Rouge ID |
mKIAA0362
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002017 | 366 | 471 | PF00435 | Spectrin repeat |
IPR000219 | 650 | 825 | PF00621 | DH | |
IPR001849 | 845 | 960 | PF00169 | Pleckstrin-like | |
HMMSmart | IPR001251 | 90 | 236 | SM00516 | Cellular retinaldehyde-binding/triple function |
IPR002017 | 369 | 470 | SM00150 | Spectrin repeat | |
IPR000219 | 650 | 825 | SM00325 | DH | |
IPR001849 | 845 | 962 | SM00233 | Pleckstrin-like | |
ProfileScan | IPR001251 | 67 | 239 | PS50191 | Cellular retinaldehyde-binding/triple function |
IPR000219 | 646 | 826 | PS50010 | DH | |
IPR001849 | 844 | 960 | PS50003 | Pleckstrin-like | |
ScanRegExp | IPR001331 | 775 | 800 | PS00741 | Guanine-nucleotide dissociation stimulator |
![]() |
---|
Primer_f | TATGGGGAGGGTCACACAAGG |
---|---|
Primer_r | GTGCGGAATCAAATAGGAAGC |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TATGGGGAGGGTCACACAAGG |
Primer_r | GTGCGGAATCAAATAGGAAGC |
PCR product length | 163 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |