Order Kazusa clone(s) from : ![]() |
Product ID | ORK06217 |
---|---|
Accession No | AB046859 |
Description | Obscurin (Obscurin-myosin light chain kinase) (Obscurin-MLCK) (Obscurin-RhoGEF). |
Clone name | af14886 |
Vector information | |
cDNA sequence | DNA sequence (7835 bp) Predicted protein sequence (2584 aa) |
Source | Human brain (amygdala) |
Note | We replaced fj06072, former representative clones for KIAA1639 with af14886. (2005/08/06) |
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 79 bp |
---|---|
Genome contig ID | gi89161185f_226489402 |
PolyA signal sequence (AATAAA,-24) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (143798 - 143847) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 1 | f | 226589206 | 226633198 | 45 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR000719 | 1084 | 1337 | PD000001 | Protein kinase |
IPR000719 | 2297 | 2531 | PD000001 | Protein kinase | |
HMMPfam | IPR013098 | 1 | 81 | PF07679 | Immunoglobulin I-set |
IPR000219 | 312 | 492 | PF00621 | DH | |
IPR001849 | 512 | 620 | PF00169 | Pleckstrin-like | |
IPR013098 | 630 | 722 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 724 | 815 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 973 | 1062 | PF07679 | Immunoglobulin I-set | |
IPR000719 | 1084 | 1337 | PF00069 | Protein kinase | |
IPR013098 | 2079 | 2169 | PF07679 | Immunoglobulin I-set | |
IPR000719 | 2288 | 2490 | PF00069 | Protein kinase | |
HMMSmart | IPR003599 | 1 | 82 | SM00409 | Immunoglobulin subtype |
IPR003598 | 8 | 71 | SM00408 | Immunoglobulin subtype 2 | |
IPR000219 | 312 | 492 | SM00325 | DH | |
IPR001849 | 512 | 622 | SM00233 | Pleckstrin-like | |
IPR003599 | 636 | 723 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 642 | 710 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 730 | 816 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 736 | 805 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 979 | 1063 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 985 | 1052 | SM00408 | Immunoglobulin subtype 2 | |
IPR001245 | 1084 | 1337 | SM00219 | Tyrosine protein kinase | |
IPR002290 | 1084 | 1337 | SM00220 | Serine/threonine protein kinase | |
IPR003599 | 2085 | 2171 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 2091 | 2159 | SM00408 | Immunoglobulin subtype 2 | |
IPR002290 | 2288 | 2540 | SM00220 | Serine/threonine protein kinase | |
ProfileScan | IPR007110 | 1 | 82 | PS50835 | Immunoglobulin-like |
IPR000219 | 308 | 493 | PS50010 | DH | |
IPR001849 | 511 | 620 | PS50003 | Pleckstrin-like | |
IPR007110 | 630 | 713 | PS50835 | Immunoglobulin-like | |
IPR007110 | 724 | 816 | PS50835 | Immunoglobulin-like | |
IPR007110 | 973 | 1061 | PS50835 | Immunoglobulin-like | |
IPR000719 | 1084 | 1337 | PS50011 | Protein kinase | |
IPR007110 | 2079 | 2168 | PS50835 | Immunoglobulin-like | |
IPR003961 | 2173 | 2260 | PS50853 | Fibronectin | |
IPR000719 | 2288 | 2540 | PS50011 | Protein kinase | |
ScanRegExp | IPR001547 | 1061 | 1070 | PS00659 | Glycoside hydrolase |
IPR000719 | 1090 | 1113 | PS00107 | Protein kinase | |
IPR008271 | 1199 | 1211 | PS00108 | Serine/threonine protein kinase | |
IPR008266 | 2403 | 2415 | PS00109 | Tyrosine protein kinase |
![]() |
Primer_f | GTTCCTGAAATCCATGCCTGC |
---|---|
Primer_r | CTTGTAGCTCATCAGGGAACG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | CCR |
---|---|
Primer_f | ATATCAAGTACCTCCCATTCG |
Primer_r | CTCTGACTCCTCTGTGATCTC |
PCR product length | 176 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |