Order Kazusa clone(s) from : ![]() |
Product ID | ORK00247 |
---|---|
Accession No | AB046788 |
Description | roundabout guidance receptor 2, transcript variant 2 |
Clone name | fh22308 |
Vector information | |
cDNA sequence | DNA sequence (5598 bp) Predicted protein sequence (1380 aa) |
HaloTag ORF Clone |
FHC00247
![]() |
Flexi ORF Clone | FXC00247 |
Source | Human fetal brain |
Rouge ID |
mKIAA1568
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
Length of 3'UTR | 1455 bp |
---|---|
Genome contig ID | gi89161205f_77072621 |
PolyA signal sequence (AATAAA,-29) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (706732 - 706781) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 3 | f | 77172621 | 77779351 | 26 | 99.7 | Perfect prediction |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR013098 | 33 | 130 | PF07679 | Immunoglobulin I-set |
IPR013098 | 135 | 223 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 227 | 312 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 316 | 410 | PF07679 | Immunoglobulin I-set | |
IPR013098 | 420 | 507 | PF07679 | Immunoglobulin I-set | |
IPR003961 | 524 | 609 | PF00041 | Fibronectin | |
IPR003961 | 650 | 715 | PF00041 | Fibronectin | |
IPR003961 | 738 | 828 | PF00041 | Fibronectin | |
HMMSmart | IPR003599 | 39 | 131 | SM00409 | Immunoglobulin subtype |
IPR003598 | 45 | 119 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 141 | 224 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 147 | 212 | SM00408 | Immunoglobulin subtype 2 | |
IPR003599 | 233 | 313 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 239 | 302 | SM00408 | Immunoglobulin subtype 2 | |
IPR003596 | 243 | 297 | SM00406 | Immunoglobulin V-set | |
IPR003599 | 322 | 411 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 328 | 400 | SM00408 | Immunoglobulin subtype 2 | |
IPR003596 | 332 | 395 | SM00406 | Immunoglobulin V-set | |
IPR003599 | 426 | 508 | SM00409 | Immunoglobulin subtype | |
IPR003598 | 432 | 497 | SM00408 | Immunoglobulin subtype 2 | |
IPR003596 | 436 | 492 | SM00406 | Immunoglobulin V-set | |
IPR003961 | 524 | 606 | SM00060 | Fibronectin | |
IPR003961 | 640 | 723 | SM00060 | Fibronectin | |
IPR003961 | 738 | 825 | SM00060 | Fibronectin | |
ProfileScan | IPR007110 | 33 | 129 | PS50835 | Immunoglobulin-like |
IPR007110 | 135 | 222 | PS50835 | Immunoglobulin-like | |
IPR007110 | 227 | 311 | PS50835 | Immunoglobulin-like | |
IPR007110 | 316 | 411 | PS50835 | Immunoglobulin-like | |
IPR007110 | 419 | 506 | PS50835 | Immunoglobulin-like | |
IPR003961 | 524 | 615 | PS50853 | Fibronectin | |
IPR003961 | 636 | 733 | PS50853 | Fibronectin | |
IPR003961 | 738 | 834 | PS50853 | Fibronectin |
Method | No. | N terminal | transmembrane region | C terminal | type | length | SOSUI2 | 1 | 1 | VKMSLLMFTQLLLCGFLYVRVD | 22 | PRIMARY | 22 |
---|
![]() |
Primer_f | AGGGAAGGAATGACAGATGAG |
---|---|
Primer_r | CTATGTCAAGAAGGTCGCTGG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | unigene |
---|---|
Primer_f | - |
Primer_r | - |
PCR product length | - |
PCR conditions | - |