ROUGE |
Gene/Protein Characteristic Table for mKIAA0191 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220327 |
---|---|
mbp19358 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4710 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 38 bp Genome contig ID gi65493515f_107338133 PolyA signal sequence
(None) +----*----+----*----+----*----+----
CAGCCCACAGCAACCAGCCAATCCTGCTGTCTCAAFlanking genome sequence
(179598 - 179647) ----+----*----+----*----+----*----+----*----+----*
GGGTATCCGTACCTCAGTGTCAGTTACACTCAGCAGAAAAAGTGACATTA
KIAA Alignment based on: KIAA0191 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..4672
Length: 1556 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |