KIAA0135

Product ID	ORK00421
Accession No	D50925
Description	PAS domain containing serine/threonine kinase, transcript variant 2
Clone name	ha01203s1
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4326 bp) Predicted protein sequence (1351 aa)
HaloTag ORF Clone	FHC00421
Flexi ORF Clone	FXC00421
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0135 by Kazusa Mouse cDNA Project
Note	We replaced ha01203, former representative clones for KIAA0135 with ha01203s1. (2002/5/10)

Length: 4326 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	269 bp
Genome contig ID	gi89161199r_241594385
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- ACTGTTTTATATTATTAAAGGGCTTTTAATTTGTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTTCTGAAGGCATGAGTGTTTTCTCTTTCTACTTTTGTATATGTGCAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	2	r	241694385	241737523	18	99.5	Perfect prediction

Length: 1351 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09616	100.0	PAS domain-cont...	synthetic construct
EAW71241	99.6	PAS domain cont...	Homo sapiens
EAW71236	99.5	PAS domain cont...	Homo sapiens
AAK69752	99.1	PAS-kinase [Hom...	Homo sapiens
Q96RG2	99.1	PAS domain-cont...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058763	3.9e-18	31.9	KIAA1860
D43636	3.9e-17	32.7	KIAA0096
AB058714	5.2e-17	35.8	KIAA1811
AB011109	7.1e-17	32.6	KIAA0537
AB018324	1.8e-16	29.5	KIAA0781

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	1025	1278	PD000001	Protein kinase
HMMPfam	IPR013767	154	256	PF00989	PAS fold
HMMPfam	IPR000719	1020	1279	PF00069	Protein kinase
HMMSmart	IPR000014	142	209	SM00091	PAS
	IPR000014	356	423	SM00091	PAS
	IPR001245	1020	1277	SM00219	Tyrosine protein kinase
	IPR002290	1020	1279	SM00220	Serine/threonine protein kinase
HMMTigr	IPR000014	138	265	TIGR00229	PAS
ProfileScan	IPR000014	155	211	PS50112	PAS
ProfileScan	IPR000719	1020	1279	PS50011	Protein kinase
ScanRegExp	IPR000719	1026	1053	PS00107	Protein kinase
ScanRegExp	IPR008271	1152	1164	PS00108	Serine/threonine protein kinase

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	358	ASVWVFCTISGLITLLPDGTIHG	380	PRIMARY	23
SOSUI2	2	402	ITFLIPGFYSYMDLAYNSSLQLP	424	SECONDARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TTCCTGCTTTTCTCCACTTGG
Primer_r	CATCACTGTCTTCTGTTCTGG
PCR product length	146 bp
PCR conditions	95 °C15 sec62 °C120 sec30 cycles