KIAA0096

Product ID	ORK00407
Accession No	D43636
Description	SNF related kinase, transcript variant 1
Clone name	ha01240s1
Vector information	The cDNA fragment was originally inserted at the EcoRV-NotI ... The cDNA fragment was originally inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR) without using any linker or adapter and a RT-PCR product (1-1013) was subcloned upstream of the cDNA (1014-4882). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA GGCCGCGGGA ATTCGATT-5' end of cDNA.
cDNA sequence	DNA sequence (4882 bp) Predicted protein sequence (766 aa)
HaloTag ORF Clone	FHC00407
Flexi ORF Clone	FXC00407
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0096 by Kazusa Mouse cDNA Project
Note	We replaced ha01240, former representative clones for KIAA0096 with ha01240s1. (2002/5/10)

Length: 4882 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	2580 bp
Genome contig ID	gi89161205f_43219696
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- CCAAATAATAAAGTGACATATTGGTGTTCAGCAAT
Flanking genome sequence (147940 - 147989)	----+--------+--------+--------+--------+----* ATAAACCGTGTCCTGTGTTGTATTGCTTCTCATGAGTGTAGCTTTGTGTG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	43319696	43367634	5	99.2	Perfect prediction

Length: 766 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NRH2	100.0	SNF-related ser...	Homo sapiens
AAH71567	99.6	SNRK protein [H...	Homo sapiens
XP_516395	99.6	SNF related kin...	Pan troglodytes
AAF86944	99.7	HSNFRK [Homo sa...	Homo sapiens
BAF84049	99.7	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018324	5.4e-30	34.4	KIAA0781
AB023216	2.7e-29	38.0	KIAA0999
AB058763	7e-29	32.6	KIAA1860
D79997	5.1e-23	36.5	KIAA0175
AB011109	1.5e-19	28.6	KIAA0537

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	17	269	PD000001	Protein kinase
HMMPfam	IPR000719	17	270	PF00069	Protein kinase
HMMPfam	IPR000449	295	335	PF00627	Ubiquitin-associated/Translation elongation factor EF1B
HMMSmart	IPR001245	17	270	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	17	270	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	17	270	PS50011	Protein kinase
ProfileScan	IPR000449	292	335	PS50030	Ubiquitin-associated/Translation elongation factor EF1B
ScanRegExp	IPR000719	23	46	PS00107	Protein kinase
ScanRegExp	IPR008271	136	148	PS00108	Serine/threonine protein kinase

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	CTAATTACACGGATGCTACAG
Primer_r	AATGATGCTGTTGTGCTCCTC
PCR product length	165 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles