KIAA0557

Product ID	ORK00562
Accession No	AB011129
Description	zinc finger protein 500, transcript variant 1
Clone name	hh01334
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (5627 bp) Predicted protein sequence (493 aa)
HaloTag ORF Clone	FHC00562
Flexi ORF Clone	FXC00562
Source	Human adult brain

Length: 5627 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	4144 bp
Genome contig ID	gi51511732r_4638353
PolyA signal sequence (None)	+--------+--------+----*----+---- CCAACCTGGGCAACACCGTGAGACCCCATCTCTAC
Flanking genome sequence (99888 - 99839)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAATTAGCTGGACATGGTGGTGTGCACCTGTAG

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	16	r	4738241	4756020	5	99.1	Perfect prediction

Length: 493 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
O60304	5.5e-179	100.0	Zinc finger pro...	Homo sapiens
XP_001098209	4e-167	94.2	zinc finger pro...	Macaca mulatta
BAG60301	5.8e-160	100.0	unnamed protein...	Homo sapiens
AAI21015	3e-101	100.0	ZNF500 protein ...	Homo sapiens
AAH04125	1.9e-84	100.0	ZNF500 protein ...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051497	1.4e-20	41.0	KIAA1710
AB002324	2.4e-20	38.8	KIAA0326
AB075842	3.9e-19	32.4	KIAA1962
AB058777	7.6e-19	59.4	KIAA1874
AB075849	1.5e-18	55.5	KIAA1969

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR007087	338	361	PD000003	Zinc finger
	IPR007087	366	389	PD000003	Zinc finger
	IPR007087	394	417	PD000003	Zinc finger
	IPR007087	422	445	PD000003	Zinc finger
HMMPfam	IPR003309	57	152	PF02023	Transcriptional regulator SCAN
	IPR001909	237	273	PF01352	KRAB box
	IPR007087	338	360	PF00096	Zinc finger
	IPR007087	366	388	PF00096	Zinc finger
	IPR007087	394	416	PF00096	Zinc finger
	IPR007087	422	444	PF00096	Zinc finger
	IPR007087	450	472	PF00096	Zinc finger
HMMSmart	IPR003309	59	165	SM00431	Transcriptional regulator SCAN
	IPR015880	338	360	SM00355	Zinc finger
	IPR015880	366	388	SM00355	Zinc finger
	IPR015880	394	416	SM00355	Zinc finger
	IPR015880	422	444	SM00355	Zinc finger
	IPR015880	450	472	SM00355	Zinc finger
ProfileScan	IPR003309	63	144	PS50804	Transcriptional regulator SCAN
	IPR007087	338	365	PS50157	Zinc finger
	IPR007087	366	393	PS50157	Zinc finger
	IPR007087	394	421	PS50157	Zinc finger
	IPR007087	422	449	PS50157	Zinc finger
	IPR007087	450	477	PS50157	Zinc finger
ScanRegExp	IPR007087	340	360	PS00028	Zinc finger
	IPR007087	368	388	PS00028	Zinc finger
	IPR007087	396	416	PS00028	Zinc finger
	IPR007087	424	444	PS00028	Zinc finger
	IPR007087	452	472	PS00028	Zinc finger

Primer_f	AGAGGAGTAACGAGAATTTGC
Primer_r	GATTCATAAAGGTCAAAGGCC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGAGGAGTAACGAGAATTTGC
Primer_r	GATTCATAAAGGTCAAAGGCC
PCR product length	93 bp
PCR conditions	95 °C15 sec60 °C60 sec30 cycles