Gene/Protein Characteristic Table for KIAA1962
Order Kazusa clone(s) from : Japan || Other countries
Product ID ORK00958
Accession No AB075842
Description zinc finger protein 483, transcript variant 1
Clone name hm00158
Vector information
The cDNA fragment was inserted at the SalI-NotI site of the ...
cDNA sequence DNA sequence (3655 bp)
Predicted protein sequence (746 aa)
Flexi ORF Clone FXC00958
Source Human adult brain
Features of the cloned cDNA sequence
Description

Length: 3655 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis).

N-terminal truncation Coding interruption
cloned DNA seq No warning No warning
Integrity of 3' end
Length of 3'UTR 1262 bp
Genome contig ID gi89161216f_113229366
PolyA signal sequence
(ACTAAA,-21)		 
+----*----+----*----+----*----+----
TTAGGGCATTTCATACTAAAAACAAAGCTTGTCTT
Flanking genome sequence
(117169 - 117218)		 
----+----*----+----*----+----*----+----*----+----*
AAAAAAAATTATAAGGGCTAACAACACTGGGCTTTTATTTATGTAAAGCA

Ensembl ContigView (Add our DAS server as a DAS source)


Chr f/r start end exon identity class
Ensembl gnome browser 9 f 113327334 113346533 6 99.2 Perfect prediction
Features of the protein sequence
Description

Length: 746 aa
Result of homology search against nr database (FASTA output, Multiple alignment)
Entry Exp ID% Protein Source
AAI52428 0 100.0 Zinc finger pro...
 Homo sapiens
Q8TF39 0 99.9 Zinc finger pro...
 Homo sapiens
XP_001105826 0 96.9 zinc finger pro...
 Macaca mulatta
XP_528388 0 94.8 zinc finger pro...
 Pan troglodytes
ABM54230 0 99.5 ZNF483 [Pan pan...
 Pan paniscus
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of homology search against HUGE database (FASTA output, Multiple alignment)
Entry Exp ID% HUGE_ID
AB046831 3.5e-63 47.9 KIAA1611
AB037852 4.8e-59 39.4 KIAA1431
AB037770 6.3e-59 35.4 KIAA1349
AB058755 1.1e-58 49.4 KIAA1852
AB107355 9.3e-58 41.3 KIAA2033
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Result of motif / domain search (InterProScan and SOSUI)

Result of InterProScan

Search method interpro_ID From To Entry Definition
BlastProDom IPR007087 441 464 PD000003 Zinc finger
IPR007087 469 492 PD000003 Zinc finger
IPR007087 497 520 PD000003 Zinc finger
IPR007087 525 548 PD000003 Zinc finger
IPR007087 581 604 PD000003 Zinc finger
IPR007087 637 660 PD000003 Zinc finger
IPR007087 665 688 PD000003 Zinc finger
IPR007087 693 716 PD000003 Zinc finger
HMMPfam IPR003309 48 142 PF02023 Transcriptional regulator SCAN
IPR001909 172 212 PF01352 KRAB box
IPR007087 441 463 PF00096 Zinc finger
IPR007087 469 491 PF00096 Zinc finger
IPR007087 497 519 PF00096 Zinc finger
IPR007087 525 547 PF00096 Zinc finger
IPR007087 553 575 PF00096 Zinc finger
IPR007087 581 603 PF00096 Zinc finger
IPR007087 609 631 PF00096 Zinc finger
IPR007087 637 659 PF00096 Zinc finger
IPR007087 665 687 PF00096 Zinc finger
IPR007087 693 715 PF00096 Zinc finger
IPR007087 721 743 PF00096 Zinc finger
HMMSmart IPR003309 50 158 SM00431 Transcriptional regulator SCAN
IPR001909 172 232 SM00349 KRAB box
IPR015880 441 463 SM00355 Zinc finger
IPR015880 469 491 SM00355 Zinc finger
IPR015880 497 519 SM00355 Zinc finger
IPR015880 525 547 SM00355 Zinc finger
IPR015880 553 575 SM00355 Zinc finger
IPR015880 581 603 SM00355 Zinc finger
IPR015880 609 631 SM00355 Zinc finger
IPR015880 637 659 SM00355 Zinc finger
IPR015880 665 687 SM00355 Zinc finger
IPR015880 693 715 SM00355 Zinc finger
IPR015880 721 743 SM00355 Zinc finger
ProfileScan IPR003309 54 136 PS50804 Transcriptional regulator SCAN
IPR001909 172 243 PS50805 KRAB box
IPR007087 441 468 PS50157 Zinc finger
IPR007087 469 496 PS50157 Zinc finger
IPR007087 497 524 PS50157 Zinc finger
IPR007087 525 552 PS50157 Zinc finger
IPR007087 553 580 PS50157 Zinc finger
IPR007087 581 608 PS50157 Zinc finger
IPR007087 609 636 PS50157 Zinc finger
IPR007087 637 664 PS50157 Zinc finger
IPR007087 665 692 PS50157 Zinc finger
IPR007087 693 720 PS50157 Zinc finger
IPR007087 721 746 PS50157 Zinc finger
ScanRegExp IPR007087 443 463 PS00028 Zinc finger
IPR007087 471 491 PS00028 Zinc finger
IPR007087 499 519 PS00028 Zinc finger
IPR007087 527 547 PS00028 Zinc finger
IPR007087 555 575 PS00028 Zinc finger
IPR007087 583 603 PS00028 Zinc finger
IPR007087 611 631 PS00028 Zinc finger
IPR007087 639 659 PS00028 Zinc finger
IPR007087 667 687 PS00028 Zinc finger
IPR007087 695 715 PS00028 Zinc finger
IPR007087 723 743 PS00028 Zinc finger
Expression profile
Description

RT-PCR-ELISA
Experimental conditions
Primer_f TGGAAAACCTCAGGAACCTAG
Primer_r AAAGCTGATTCATCTAGTCGG
PCR conditions 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RH mapping information
Description

Chromosome No. 9
Experimental conditions
Panel name genbank
Primer_f -
Primer_r -
PCR product length -
PCR conditions -
Order Kazusa clone(s) from : Japan || Other countries
Back to the HUGE Protein Database homepage
Send a message to office AT kazusa.or.jp