KIAA0237

Product ID	ORK00472
Accession No	D87074
Description	regulating synaptic membrane exocytosis 3
Clone name	ha06286
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pSPORT1 vector (GenBank Accession No. U12390, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (7239 bp) Predicted protein sequence (315 aa)
HaloTag ORF Clone	FHC00472
Flexi ORF Clone	FXC00472
Source	Human adult brain
Rouge ID	mKIAA0237 by Kazusa Mouse cDNA Project

Length: 7239 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	5837 bp
Genome contig ID	gi89161185r_40758939
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- GCAGCAAAACATGATTAAAGTCAGTTTGAAAATGG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TTTCATGTGTTGCTTTCTGTAGATGGTTCTTCATTCTAGAAGGAAGAAAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	1	r	40858939	40903919	8	99.1	Perfect prediction

Length: 315 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG09670	7.6e-122	100.0	regulating syna...	synthetic construct
Q9UJD0	2.5e-121	99.7	Regulating syna...	Homo sapiens
XP_001084127	3.9e-121	99.4	regulating syna...	Macaca mulatta
XP_001503313	6.4e-119	97.4	similar to Regu...	Equus caballus
Q80U57	2.8e-118	97.4	Regulating syna...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018294	1.4e-56	69.5	KIAA0751
AB033054	0.001	29.0	KIAA1228

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000008	178	265	PF00168	C2 calcium-dependent membrane targeting
HMMSmart	IPR000008	177	280	SM00239	C2 calcium-dependent membrane targeting
ProfileScan	IPR000008	175	265	PS50004	C2 calcium-dependent membrane targeting
ScanRegExp	IPR001360	204	212	PS00572	Glycoside hydrolase

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	ACTTGTTGTGGTTCCCGGGTG
Primer_r	CTGCCCAAATACTGTACATGC
PCR product length	130 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles