ROUGE |
Gene/Protein Characteristic Table for mKIAA4165 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220517 |
---|---|
Protein kinase C, iota type. | |
mfj42151 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4486 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2460 bp Genome contig ID gi65492966f_30307173 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TACATTAAAATCTTTAAATAAAATGTTTAATACCTFlanking genome sequence
(156992 - 157041) ----+----*----+----*----+----*----+----*----+----*
ATGAGGAGTGGACCATTTTCAACTTAAAAACAAATGTTCCGGGCTAGAGA
Features of the protein sequence |
Description | |
Coding region: 2..2023
Length: 674 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |