Gene/Protein Characteristic Table for mKIAA0175

Length: 2423 bp

Restriction map

Length of 3'UTR	344 bp
Genome contig ID	gi65493515f_44116887
PolyA signal sequence (ACTAAA,-21)	+----*----+----*----+----*----+---- CAGTTTCTTTCTGAACTAAAACCATTTGTGAATAT
Flanking genome sequence (163269 - 163318)	----+----*----+----*----+----*----+----*----+----* ATCAAGCTCTTTTTTGTATCTGATTTTGATCCAAATAAAACCTCGAATGG

KIAA	Alignment based on:
KIAA0175	DNA sequence, AA sequence, Physical map

Coding region: 133..2079

Length: 648 aa

Entry Exp ID% Protein Source EDL02426 0 99.8 maternal embryo... Mus musculus Q61846 0 100.0 Maternal embryo... Mus musculus AAB72030 0 99.8 protein kinase ... Mus musculus AAH85276 0 99.7 Maternal embryo... Mus musculus BAE26188 0 99.5 unnamed protein... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220191 1.5e-37 29.5 mKIAA4207 AK173181 4.1e-37 28.9 mKIAA1477 AK220557 4.3e-37 41.6 mKIAA4230 BC020189 7.2e-32 31.8 mKIAA0096 AK173268 2.7e-31 38.5 mKIAA4256

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	21	267	PD000001	Protein kinase
HMMPfam	NULL	16	266	PF07714	NULL
	IPR000719	16	268	PF00069	Protein kinase
	IPR001772	599	648	PF02149	Kinase-associated
HMMSmart	IPR002290	16	268	SM00220	Serine/threonine protein kinase
	IPR001245	16	268	SM00219	Tyrosine protein kinase
ProfileScan	IPR000719	16	268	PS50011	Protein kinase
	IPR001772	599	648	PS50032	Kinase-associated
ScanRegExp	IPR000719	22	45	PS00107	Protein kinase
	IPR008271	133	145	PS00108	Serine/threonine protein kinase

Method	From	To	amino acid sequence
SOSUI	195	214	ADVWSMGILLYVLMCGFLPF