ROUGE

Gene/Protein Characteristic Table for mKIAA0147

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122211
Description :	PDZ-domain protein scribble. Scribble. scribble homolog 1.
Clone Name :	mbg04389 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5539 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 228 bp

Genome contig ID gi65543215r_75995837
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
TTGTGGTTTAAGAAGAATAAAGTTACCTACGTTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCTTCTCTTGTCCTTTTGTCCTGCCTGCTCATACCGATCCTCCTGCCCT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0147 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0147	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 227..5311
Length: 1694 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL29514	100.0	scribbled homol...	Mus musculus
EDL29516	98.5	scribbled homol...	Mus musculus
EDM16020	97.0	similar to PDZ-...	Rattus norvegicus
Q80U72	98.5	Protein LAP4; P...	Mus musculus
AAH62888	98.4	Scrib protein [...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220166	4.1e-60	62.6	mKIAA4018
AK122498	2.3e-35	44.8	mKIAA1365
AK122473	6.6e-35	42.9	mKIAA1225
BC049775	4.6e-11	31.0	mKIAA0862
AK220329	8.4e-07	31.3	mKIAA0231

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001611 118 131 PR00019 Leucine-rich repeat

IPR001611 230 243 PR00019 Leucine-rich repeat

HMMPfam IPR001611 94 116 PF00560 Leucine-rich repeat

IPR001611 117 139 PF00560 Leucine-rich repeat

IPR001611 140 162 PF00560 Leucine-rich repeat

IPR001611 163 185 PF00560 Leucine-rich repeat

IPR001611 209 231 PF00560 Leucine-rich repeat

IPR001611 232 254 PF00560 Leucine-rich repeat

IPR001611 255 277 PF00560 Leucine-rich repeat

IPR001611 278 300 PF00560 Leucine-rich repeat

IPR001611 301 323 PF00560 Leucine-rich repeat

IPR001611 347 369 PF00560 Leucine-rich repeat

IPR001611 370 392 PF00560 Leucine-rich repeat

IPR001611 393 415 PF00560 Leucine-rich repeat

IPR001611 416 438 PF00560 Leucine-rich repeat

IPR001478 771 855 PF00595 PDZ/DHR/GLGF

IPR001478 908 990 PF00595 PDZ/DHR/GLGF

IPR001478 1047 1133 PF00595 PDZ/DHR/GLGF

IPR001478 1143 1232 PF00595 PDZ/DHR/GLGF

HMMSmart IPR003591 93 114 SM00369 Leucine-rich repeat

NULL 115 137 SM00366 NULL

IPR003591 115 137 SM00369 Leucine-rich repeat

NULL 138 160 SM00366 NULL

IPR003591 138 161 SM00369 Leucine-rich repeat

NULL 161 183 SM00366 NULL

NULL 184 206 SM00366 NULL

IPR003591 184 206 SM00369 Leucine-rich repeat

NULL 207 229 SM00366 NULL

IPR003591 207 229 SM00369 Leucine-rich repeat

NULL 230 252 SM00366 NULL

IPR003591 230 252 SM00369 Leucine-rich repeat

NULL 253 275 SM00366 NULL

IPR003591 253 275 SM00369 Leucine-rich repeat

NULL 276 298 SM00366 NULL

IPR003591 276 298 SM00369 Leucine-rich repeat

NULL 299 321 SM00366 NULL

IPR003591 299 322 SM00369 Leucine-rich repeat

NULL 322 344 SM00366 NULL

NULL 345 367 SM00366 NULL

IPR003591 345 367 SM00369 Leucine-rich repeat

NULL 368 390 SM00366 NULL

IPR003591 368 391 SM00369 Leucine-rich repeat

NULL 391 413 SM00366 NULL

IPR003591 392 413 SM00369 Leucine-rich repeat

IPR003591 414 437 SM00369 Leucine-rich repeat

IPR001478 779 858 SM00228 PDZ/DHR/GLGF

IPR001478 913 993 SM00228 PDZ/DHR/GLGF

IPR001478 1055 1136 SM00228 PDZ/DHR/GLGF

IPR001478 1152 1235 SM00228 PDZ/DHR/GLGF

ProfileScan IPR003591 77 146 PS50506 Leucine-rich repeat

NULL 184 444 PS50319 NULL

IPR003591 216 284 PS50506 Leucine-rich repeat

NULL 713 739 PS50313 NULL

IPR001478 771 858 PS50106 PDZ/DHR/GLGF

IPR001478 905 993 PS50106 PDZ/DHR/GLGF

IPR001478 1047 1136 PS50106 PDZ/DHR/GLGF

IPR001478 1143 1231 PS50106 PDZ/DHR/GLGF

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001611	118	131	PR00019	Leucine-rich repeat
IPR001611	230	243	PR00019	Leucine-rich repeat
HMMPfam	IPR001611	94	116	PF00560	Leucine-rich repeat
IPR001611	117	139	PF00560	Leucine-rich repeat
IPR001611	140	162	PF00560	Leucine-rich repeat
IPR001611	163	185	PF00560	Leucine-rich repeat
IPR001611	209	231	PF00560	Leucine-rich repeat
IPR001611	232	254	PF00560	Leucine-rich repeat
IPR001611	255	277	PF00560	Leucine-rich repeat
IPR001611	278	300	PF00560	Leucine-rich repeat
IPR001611	301	323	PF00560	Leucine-rich repeat
IPR001611	347	369	PF00560	Leucine-rich repeat
IPR001611	370	392	PF00560	Leucine-rich repeat
IPR001611	393	415	PF00560	Leucine-rich repeat
IPR001611	416	438	PF00560	Leucine-rich repeat
IPR001478	771	855	PF00595	PDZ/DHR/GLGF
IPR001478	908	990	PF00595	PDZ/DHR/GLGF
IPR001478	1047	1133	PF00595	PDZ/DHR/GLGF
IPR001478	1143	1232	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR003591	93	114	SM00369	Leucine-rich repeat
NULL	115	137	SM00366	NULL
IPR003591	115	137	SM00369	Leucine-rich repeat
NULL	138	160	SM00366	NULL
IPR003591	138	161	SM00369	Leucine-rich repeat
NULL	161	183	SM00366	NULL
NULL	184	206	SM00366	NULL
IPR003591	184	206	SM00369	Leucine-rich repeat
NULL	207	229	SM00366	NULL
IPR003591	207	229	SM00369	Leucine-rich repeat
NULL	230	252	SM00366	NULL
IPR003591	230	252	SM00369	Leucine-rich repeat
NULL	253	275	SM00366	NULL
IPR003591	253	275	SM00369	Leucine-rich repeat
NULL	276	298	SM00366	NULL
IPR003591	276	298	SM00369	Leucine-rich repeat
NULL	299	321	SM00366	NULL
IPR003591	299	322	SM00369	Leucine-rich repeat
NULL	322	344	SM00366	NULL
NULL	345	367	SM00366	NULL
IPR003591	345	367	SM00369	Leucine-rich repeat
NULL	368	390	SM00366	NULL
IPR003591	368	391	SM00369	Leucine-rich repeat
NULL	391	413	SM00366	NULL
IPR003591	392	413	SM00369	Leucine-rich repeat
IPR003591	414	437	SM00369	Leucine-rich repeat
IPR001478	779	858	SM00228	PDZ/DHR/GLGF
IPR001478	913	993	SM00228	PDZ/DHR/GLGF
IPR001478	1055	1136	SM00228	PDZ/DHR/GLGF
IPR001478	1152	1235	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR003591	77	146	PS50506	Leucine-rich repeat
NULL	184	444	PS50319	NULL
IPR003591	216	284	PS50506	Leucine-rich repeat
NULL	713	739	PS50313	NULL
IPR001478	771	858	PS50106	PDZ/DHR/GLGF
IPR001478	905	993	PS50106	PDZ/DHR/GLGF
IPR001478	1047	1136	PS50106	PDZ/DHR/GLGF
IPR001478	1143	1231	PS50106	PDZ/DHR/GLGF

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	228 bp
Genome contig ID	gi65543215r_75995837
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- TTGTGGTTTAAGAAGAATAAAGTTACCTACGTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTTCTCTTGTCCTTTTGTCCTGCCTGCTCATACCGATCCTCCTGCCCT

Gene/Protein Characteristic Table for mKIAA0147

Features of the cloned DNA sequence

Features of the protein sequence