ROUGE

Gene/Protein Characteristic Table for mKIAA0705

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122349
Description :	Atrophin-1 interacting protein 1.
Clone Name :	mbg00550 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6008 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2642 bp

Genome contig ID gi65498774f_18405236
PolyA signal sequence
(AATAAA,-16)
+----*----+----*----+----*----+----
ATATTCTAAAACACTGTCAAATAAAATATATATCC
Flanking genome sequence
(751563 - 751612)
----+----*----+----*----+----*----+----*----+----*
AAAAATCTTTTCTTTTTCCAGCTATATAAACTGTGTGTTAATTTTAATTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0705 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0705	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..3342, 3456..3872
Length: 1252 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9WVQ1	100.0	Membrane-associ...	Mus musculus
BAA82294	100.0	activin recepto...	Mus musculus
EDL99442	98.8	membrane associ...	Rattus norvegicus
O88382	98.6	Membrane-associ...	Rattus norvegicus
EDL99441	98.9	membrane associ...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220499	2.4e-32	47.9	mKIAA4129
AK173225	2.3e-19	44.1	mKIAA1634

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002349 149 162 PR00403 WW

IPR002349 164 178 PR00403 WW

HMMPfam IPR001202 149 178 PF00397 WW/Rsp5/WWP

IPR001202 195 224 PF00397 WW/Rsp5/WWP

IPR001478 271 352 PF00595 PDZ/DHR/GLGF

IPR001478 450 525 PF00595 PDZ/DHR/GLGF

IPR001478 621 704 PF00595 PDZ/DHR/GLGF

IPR001478 765 852 PF00595 PDZ/DHR/GLGF

IPR001478 985 1064 PF00595 PDZ/DHR/GLGF

HMMSmart IPR008145 1 136 SM00072 Guanylate kinase/L-type calcium channel region

IPR001202 148 180 SM00456 WW/Rsp5/WWP

IPR001202 194 226 SM00456 WW/Rsp5/WWP

IPR001478 279 355 SM00228 PDZ/DHR/GLGF

IPR001478 458 528 SM00228 PDZ/DHR/GLGF

IPR001478 631 707 SM00228 PDZ/DHR/GLGF

IPR001478 774 855 SM00228 PDZ/DHR/GLGF

IPR001478 993 1067 SM00228 PDZ/DHR/GLGF

ProfileScan IPR001202 147 180 PS50020 WW/Rsp5/WWP

IPR001202 193 226 PS50020 WW/Rsp5/WWP

IPR001478 271 340 PS50106 PDZ/DHR/GLGF

IPR001478 450 513 PS50106 PDZ/DHR/GLGF

IPR001478 623 705 PS50106 PDZ/DHR/GLGF

IPR001478 765 855 PS50106 PDZ/DHR/GLGF

IPR001478 985 1067 PS50106 PDZ/DHR/GLGF

ScanRegExp IPR001202 153 178 PS01159 WW/Rsp5/WWP

IPR001202 199 224 PS01159 WW/Rsp5/WWP

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002349	149	162	PR00403	WW
IPR002349	164	178	PR00403	WW
HMMPfam	IPR001202	149	178	PF00397	WW/Rsp5/WWP
IPR001202	195	224	PF00397	WW/Rsp5/WWP
IPR001478	271	352	PF00595	PDZ/DHR/GLGF
IPR001478	450	525	PF00595	PDZ/DHR/GLGF
IPR001478	621	704	PF00595	PDZ/DHR/GLGF
IPR001478	765	852	PF00595	PDZ/DHR/GLGF
IPR001478	985	1064	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR008145	1	136	SM00072	Guanylate kinase/L-type calcium channel region
IPR001202	148	180	SM00456	WW/Rsp5/WWP
IPR001202	194	226	SM00456	WW/Rsp5/WWP
IPR001478	279	355	SM00228	PDZ/DHR/GLGF
IPR001478	458	528	SM00228	PDZ/DHR/GLGF
IPR001478	631	707	SM00228	PDZ/DHR/GLGF
IPR001478	774	855	SM00228	PDZ/DHR/GLGF
IPR001478	993	1067	SM00228	PDZ/DHR/GLGF
ProfileScan	IPR001202	147	180	PS50020	WW/Rsp5/WWP
IPR001202	193	226	PS50020	WW/Rsp5/WWP
IPR001478	271	340	PS50106	PDZ/DHR/GLGF
IPR001478	450	513	PS50106	PDZ/DHR/GLGF
IPR001478	623	705	PS50106	PDZ/DHR/GLGF
IPR001478	765	855	PS50106	PDZ/DHR/GLGF
IPR001478	985	1067	PS50106	PDZ/DHR/GLGF
ScanRegExp	IPR001202	153	178	PS01159	WW/Rsp5/WWP
IPR001202	199	224	PS01159	WW/Rsp5/WWP

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2642 bp
Genome contig ID	gi65498774f_18405236
PolyA signal sequence (AATAAA,-16)	+--------+--------+----*----+---- ATATTCTAAAACACTGTCAAATAAAATATATATCC
Flanking genome sequence (751563 - 751612)	----+--------+--------+--------+--------+----* AAAAATCTTTTCTTTTTCCAGCTATATAAACTGTGTGTTAATTTTAATTT

Gene/Protein Characteristic Table for mKIAA0705

Features of the cloned DNA sequence

Features of the protein sequence