ROUGE |
Gene/Protein Characteristic Table for mKIAA4104 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220489 |
---|---|
RAB GTPase activating protein 1. rab6 GTPase activating protein. |
|
mbg15134 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4788 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1550 bp Genome contig ID gi66880554f_37301547 PolyA signal sequence
(ATTAAA,-23) +----*----+----*----+----*----+----
AACAGCATATTCATTAAATATTTTGGTACAAACAGFlanking genome sequence
(197055 - 197104) ----+----*----+----*----+----*----+----*----+----*
CATTGCTTCATACAAAAGTAGTTTTATGTTTGCATATTCCTTTCCCACCC
Features of the protein sequence |
Description | |
Coding region: 41..3235
Length: 1065 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |