ROUGE |
Gene/Protein Characteristic Table for mKIAA1108 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122445 |
---|---|
TBC1 domain family member 1. | |
mbg02140 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6465 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1550 bp Genome contig ID gi65498774f_62857216 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
ACAGTAAGAAAAGAGCAATAAAACAGATTATTCACFlanking genome sequence
(290929 - 290978) ----+----*----+----*----+----*----+----*----+----*
ACCTGTGTCTTCGTGTTGTCTGTTTTTCAAACTCTGAATTTTGGCTTTAC
KIAA Alignment based on: KIAA1108 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1115..4915
Length: 1266 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |