ROUGE

Gene/Protein Characteristic Table for mKIAA4015

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220446
Description :	RNA binding motif protein 6.
Clone Name :	mfj41118 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 3858 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 117 bp

Genome contig ID gi65519420r_107741645
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
CTAGAACTTTTTTAAATAAACTTTTTTTCAATGTG
Flanking genome sequence
(99908 - 99859)
----+----*----+----*----+----*----+----*----+----*
AATAAATTTTGTTAAAGTTTTTTTTTTTCCTACAATGGGTAGAGATTAGA

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 412..3738
Length: 1109 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL21230	99.8	RNA binding mot...	Mus musculus
NP_035381	99.5	RNA binding mot...	Mus musculus
AAH26129	99.1	Rbm6 protein [M...	Mus musculus
CAA07065	99.2	RNA binding pro...	Mus musculus
EDL77214	95.1	similar to Rbm6...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122208	5.1e-14	26.2	mKIAA0122

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR000504 449 524 SM00360 RNA-binding region RNP-1 (RNA recognition motif)

IPR000504 646 725 SM00360 RNA-binding region RNP-1 (RNA recognition motif)

ProfileScan IPR000504 448 528 PS50102 RNA-binding region RNP-1 (RNA recognition motif)

IPR007087 941 971 PS50157 Zinc finger

IPR000467 1037 1083 PS50174 D111/G-patch

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR000504	449	524	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
IPR000504	646	725	SM00360	RNA-binding region RNP-1 (RNA recognition motif)
ProfileScan	IPR000504	448	528	PS50102	RNA-binding region RNP-1 (RNA recognition motif)
IPR007087	941	971	PS50157	Zinc finger
IPR000467	1037	1083	PS50174	D111/G-patch

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	117 bp
Genome contig ID	gi65519420r_107741645
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- CTAGAACTTTTTTAAATAAACTTTTTTTCAATGTG
Flanking genome sequence (99908 - 99859)	----+--------+--------+--------+--------+----* AATAAATTTTGTTAAAGTTTTTTTTTTTCCTACAATGGGTAGAGATTAGA

Gene/Protein Characteristic Table for mKIAA4015

Features of the cloned DNA sequence

Features of the protein sequence